microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • Drosophila
        • Mouse
        • S. cerevisiae
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / Caenorhabditis elegans che-5 is allelic...
Caenorhabditis elegans che-5 is allelic to gcy-22
Hirofumi Kunitomo1 and Yuichi Iino1
1Department of Biological Sciences, School of Science, The University of Tokyo
Correspondence to: Hirofumi Kunitomo (kunitomo@bs.s.u-tokyo.ac.jp)

Abstract

Figure 1. che-5(e1073) carries mutations in gcy-22 that are responsible for chemotaxis defects of the mutants: (A) Schematic diagram of gcy-22a gene structure. Boxes represent exons. Protein domains and the nucleotide substitutions found in e1073 are indicated above and below the diagram, respectively. (B) Complementation test between che-5(e1073) and gcy-22(tm2364). Salt concentration chemotaxis was observed in e1073/tm2364 heterozygotes and their parental strains. e1073 failed to complement tm2364. n = 5, Mean±SEM, *p ≤ 0.001, compared to mIs11, Dunnett’s test. (C) ASER-specific expression of gcy-22(+) rescued the chemotaxis defect of the che-5(e1073) mutants. n = 4 or 5, Mean±SEM, *p ≤ 0.01, compared to wild type, Dunnett’s test.

Description

Mechanisms of chemotactic behaviors have been of great interest in C. elegans neuroscience since the early days of its research (Ward 1973). Lewis and Hodgkin (1977) systematically isolated more than ten abnormal chemotaxis (che) mutants that showed defective chemotaxis to sodium (Na+) and chloride (Cl–) ions (Lewis and Hodgkin 1977), whose responsible genes have already been molecularly characterized except for che-5(e1073). We here show that che-5(e1073) is a missense allele of gcy-22, which encodes a receptor guanylyl cyclase (rGC) specifically expressed in the ASE-right (ASER) gustatory neuron and is essential for chemosensation through the neuron.

C. elegans is attracted to the NaCl concentration at which it has experienced with food, while avoid the concentration at which it has experienced starvation. ASER plays a major role in food-associated salt concentration chemotaxis; input of salt information into ASER is required and sufficient for chemotaxis to the salt concentration associated with food (Kunitomo et al. 2013). ASE neurons, consisting of bilaterally symmetrical ASE-left (ASEL) and ASER, are the major sensory neuron for water-soluble attractants (Bargmann and Horvitz 1991). They respectively sense different sets of ions such as Na+ and Cl– (Pierce-Shimomura et al. 2001; Suzuki et al. 2008; Ortiz et al. 2009). A cyclic GMP (cGMP) signaling pathway consisting of rGCs and TAX-4/TAX-2 cyclic nucleotide-gated ion channels mediates sensory transduction in ASE (Coburn and Bargmann 1996; Komatsu et al. 1996; Ortiz et al. 2009). ASEL and ASER express distinct sets of rGCs (Ortiz et al. 2006). Of these, gcy-22 is essential for ASER to respond to multiple ion species; therefore it is proposed as a common component of chemoreceptor complexes (Ortiz et al. 2009; Adachi et al. 2010; Smith et al. 2013). To further elucidate the mechanisms of chemosensation through ASER, we characterized as yet uncloned che-5. We focused on che-5 because CB1073 che-5(e1073) mutant, the unique strain/allele of the gene, showed chemotaxis defects characteristic of ASER-specific malfunction; a severe defect in attraction to Cl–, whereas relatively moderate defect in Na+ chemotaxis (Lewis and Hodgkin 1977).

We mapped the mutation of che-5(e1073) responsible for salt chemotaxis defect between genetic positions 24.52 (single nucleotide polymorphism (SNP): WBVar00240760) and 25.54 (SNP: WBVar00053592) on chromosome V by using SNPs between N2 and CB4856 (Wicks et al. 2001). The mapped region contained an ASER-specific chemotaxis gene, gcy-22 (genetic position: 25.28). This result was unexpected from the initial report that mapped e1073 on chromosome IV (Lewis and Hodgkin1977), but consistent with a recent observation in which whole-genome sequencing failed to identify a mutation corresponding to che-5(e1073) on chromosome IV (Smith et al. 2013).

gcy-22(tm2364) harbors a deletion in the middle of gcy-22 coding region that results in a frame shift and therefore is a putative null allele (Fig. 1A). Salt concentration chemotaxis of the animals heterozygous for e1073 and tm2364 showed that the two alleles failed to complement each other, indicating that these alleles affect the same locus (Fig. 1B). Nucleotide sequencing of the gcy-22 locus revealed that e1073 carried ACG GCA CCA AAG CAC ATT AGA in which the adenine residue in bold letter was guanine in wild type (Fig. 1A). This transition results in a missense change E697K in GCY-22 isoform a. The glutamate residue is located in the kinase-like domain and well conserved in rGC proteins. In addition, CB1073 carried another nucleotide substitution within the first intron of gcy-22, TAAACTATGTAAGAAATTTCC, in which the adenine residue in bold letter was guanine in wild type (Fig. 1A). Furthermore, expression of a cDNA for gcy-22a in CB1073 in ASER-specific manner completely rescued the salt chemotaxis defect of the mutant (Fig. 1C). These results strongly indicate that che-5 is allelic to gcy-22 and the chemotaxis defect of e1073 is due to the mutations of gcy-22 locus.

Methods

Request a detailed protocol

Salt concentration chemotaxis was evaluated as described (Kunitomo et al. 2013). A chemotaxis index was calculated to quantify the behavior as follows. Chemotaxis index = {(N at high NaCl-region) – (N at low NaCl-region)} / {(total N) – (N that did not move from the origin)}, in which N represents number of animals. For complementation tests, males of PD4792 (mIs11 with gcy-22(+) background) or JN2608 (mIs11 with gcy-22(tm2364) background) were mated with CB1073 hermaphrodites. F1 progenies were tested for salt concentration chemotaxis, and crossed progeny hermaphrodites that carried mIs11 were separately counted from self-progeny hermaphrodites that did not carry the marker. For rescue experiments, 5 ng/microL gcy-5p::gcy-22a construct was introduced into CB1073 with 15 ng/microL myo-3p::venus as a transformation marker.

Reagents

Strains. The JN strains are available upon request. Others are available at Caenorhabditis Genetic Center (CGC).

Bristol N2: wild type

CB4856: wild type

CB1073: che-5(e1073) V.

JN967: gcy-22(tm2364) V.

JN2606: che-5(e1073) V; peEx2606[myo-3p::venus].

JN2607: che-5(e1073) V; peEx2607[gcy-5p::gcy-22a myo-3p::venus].

JN2608: mIs11[myo-2p::GFP pes-10p::GFP gut-promoter::GFP] IV; gcy-22(tm2364) V.

PD4792: mIs11[myo-2p::GFP pes-10p::GFP gut-promoter::GFP] IV.

Acknowledgments

N2, CB4856, PD4792, and CB1073 were provided by the CGC. tm2364 was provided by the National Bioresource Project (NBRP)-Japan.

References

Adachi T, Kunitomo H, Tomioka M, Ohno H, Okochi Y, Mori I, Iino Y. 2010. Reversal of salt preference is directed by the insulin/PI3K and Gq/PKC signaling in Caenorhabditis elegans. Genetics 186: 1309-19.
PubMed
Bargmann CI, Horvitz HR. 1991. Chemosensory neurons with overlapping functions direct chemotaxis to multiple chemicals in C. elegans. Neuron 7: 729-42.
PubMed
Coburn CM, Bargmann CI. 1996. A putative cyclic nucleotide-gated channel is required for sensory development and function in C. elegans. Neuron 17: 695-706.
PubMed
Komatsu H, Mori I, Rhee JS, Akaike N, Ohshima Y. 1996. Mutations in a cyclic nucleotide-gated channel lead to abnormal thermosensation and chemosensation in C. elegans. Neuron 17: 707-18.
PubMed
Kunitomo H, Sato H, Iwata R, Satoh Y, Ohno H, Yamada K, Iino Y. 2013. Concentration memory-dependent synaptic plasticity of a taste circuit regulates salt concentration chemotaxis in Caenorhabditis elegans. Nat Commun 4: 2210.
PubMed
Lewis JA, Hodgkin JA. 1977. Specific neuroanatomical changes in chemosensory mutants of the nematode Caenorhabditis elegans. J Comp Neurol 172: 489-510.
PubMed
Ortiz CO, Etchberger JF, Posy SL, Frøkjaer-Jensen C, Lockery S, Honig B, Hobert O. 2006. Searching for neuronal left/right asymmetry: genomewide analysis of nematode receptor-type guanylyl cyclases. Genetics 173: 131-49.
PubMed
Ortiz CO, Faumont S, Takayama J, Ahmed HK, Goldsmith AD, Pocock R, McCormick KE, Kunitomo H, Iino Y, Lockery S, Hobert O. 2009. Lateralized gustatory behavior of C. elegans is controlled by specific receptor-type guanylyl cyclases. Curr Biol 19: 996-1004.
PubMed
Pierce-Shimomura JT, Faumont S, Gaston MR, Pearson BJ, Lockery SR. 2001. The homeobox gene lim-6 is required for distinct chemosensory representations in C. elegans. Nature 410: 694-8.
PubMed
Smith HK, Luo L, O'Halloran D, Guo D, Huang XY, Samuel AD, Hobert O. 2013. Defining specificity determinants of cGMP mediated gustatory sensory transduction in Caenorhabditis elegans. Genetics 194: 885-901.
PubMed
Suzuki H, Thiele TR, Faumont S, Ezcurra M, Lockery SR, Schafer WR. 2008. Functional asymmetry in Caenorhabditis elegans taste neurons and its computational role in chemotaxis. Nature 454: 114-7.
PubMed
Ward S. 1973. Chemotaxis by the nematode Caenorhabditis elegans: identification of attractants and analysis of the response by use of mutants. Proc Natl Acad Sci U S A 70: 817-21.
PubMed
Wicks SR, Yeh RT, Gish WR, Waterston RH, Plasterk RH. 2001. Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat Genet 28: 160-4.
PubMed

Funding

Japan Society for the Promotion of Science (JSPS) KAKENHI 19K06952 and The Salt Science Foundation No. 2043 to HK. JSPS KAKENHI JP17H06113, 19H04980 and Japan Science and Technology Agency (JST) CREST JP17H06113 to YI.

Author Contributions

Hirofumi Kunitomo: Conceptualization, Investigation, Resources, Writing - original draft, Writing - review and editing, Funding acquisition
Yuichi Iino: Supervision, Funding acquisition, Writing - review and editing.

Reviewed By

Oliver Hobert

History

Received: September 19, 2020
Revision received: September 23, 2020
Accepted: October 1, 2020
Published: October 8, 2020

Copyright

© 2020 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Kunitomo, H; Iino, Y (2020). Caenorhabditis elegans che-5 is allelic to gcy-22. microPublication Biology. 10.17912/micropub.biology.000313.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430