microPublication

Get Your Data Out, Be Cited

  • About
    • Editorial Policies
      • Editorial Staff
      • Editorial Board
      • Criteria For Publication
      • Publishing Information
      • Data Sharing Policy
    • For Authors
      • Preparation And Submission Of A Manuscript
      • Peer Review Process
      • Following Acceptance
      • Appeals
    • For Reviewers
    • Why micropublish?
  • Submit a microPublication
  • Journals
    • microPublication Biology
      • Editorial Board
  • microPublications
    • Biology
      • Species
        • Arabidopsis
        • C. elegans
        • Drosophila
        • Mouse
        • S. cerevisiae
        • S. pombe
        • Xenopus
        • Zebrafish
      • Categories
        • Phenotype Data
        • Methods
        • Expression Data
        • Genotype Data
        • Integrations
        • Genetic Screens
        • Models of Human Disease
        • Software
        • Interaction data
        • Database Updates
        • Electrophysiology Data
        • Phylogenetic Data
        • Science and Society
  • Contact
  • More
    • Archives
    • FAQs
    • Newsletter
microPublication / Biology / Deletion of the RGD motif...
Deletion of the RGD motif in LON-2/glypican is associated with morphological abnormalities
Aileen Park1, Zhongqiang Qiu1 and Myeongwoo Lee1
1Baylor University Department of Biology
Correspondence to: Myeongwoo Lee (Myeongwoo_Lee@baylor.edu)

Abstract

The lon-2 gene in Caenorhabditis elegans encodes a heparan sulfate proteoglycan family glypican that negatively regulates the BMP signaling pathway responsible for controlling body length. LON-2 contains multiple functional domains, including an RGD (Arg-Gly-Asp) motif at amino acid number from 348 to 350. A novel mutant allele of lon-2 was investigated in this study. In this mutant allele, lon-2(kq348ΔRGD), the RGD motif at position 348 was deleted. Another pre-existing mutant allele, lon-2(e678), contains a ~9kb deletion and lacks most of the genomic coding sequence. The lon-2(e678) line was used as a reference allele. The novel mutant line was significantly shorter than wild-type animals, suggesting that removal of the RGD motif in LON-2 may improve its ability to inhibit BMP signaling.

Figure 1. : A. Aligned comparison of the wild-type lon-2 amino acid sequence and the mutant lon-2(ΔRGD) sequence containing total deletion of the RGD motif at amino acid position 348. The repair template sequence and synonymous mutation schemes are also included. All sequences are in the 5’ to 3’ direction. *WT: wild-type. *AA: amino acid.

Description

The lon-2 gene in Caenorhabditis elegans encodes a heparan sulfate proteoglycan family glypican that negatively regulates the BMP signaling pathway responsible for controlling body length (Gumienny et al., 2007). LON-2 contains multiple functional domains, including an RGD (Arg-Gly-Asp) motif at amino acid number from 348 to 350. RGD motifs are the cell-binding site of the extracellular matrix protein and are known to interact with cell surface receptors of the extracellular matrix, integrins (Margadant and Sonnenberg, 2010). Previous studies show that this RGD motif in LON-2 does not directly regulate BMP, but is essential to the function of soluble LON-2, suggesting that the RGD motif likely utilizes another part of the LON-2 N-terminal core glypican protein functional domain to play a role in BMP signal regulation (Taneja-Bageshwar and Gumienny 2012). These studies indicated that LON-2 acts by binding and sequestering DBL-1 and acting as an RGD-binding protein, modulating the strength of the BMP signal and thereby negatively regulating body size (Gumienny et al., 2007; Taneja-Bageshwar and Gumienny 2012). Previous analysis demonstrated that lon-2(e678) mutants are unable to regulate DBL-1 signaling and as a result of higher doses of DBL-1 are longer than wild-type animals (Gumienny et al., 2007; Suzuki et al., 1999). A novel mutant allele of lon-2 was investigated in this study. In this mutant allele, lon-2(kq348ΔRGD), the RGD motif at position 348 was deleted. The previously mentioned pre-existing mutant allele, lon-2(e678), contains a ~9kb deletion and lacks most of the genomic coding sequence (Gumienny et al., 2007). The lon-2(e678) line was used as a reference allele in order to identify the presence of morphological abnormalities (the long phenotype) in our novel mutant line. RGD mutant worms as well as wild-type worms were imaged and measured in order to screen for the presence or absence of the long phenotype in the novel mutant line. 45 wild-type animals (n=45) and 27 lon-2(ΔRGD) animals (n=27) were imaged and measured in the assay. Wild-type animals had an average body length of 1127.6 µm (SE ± 25.28 µm) and the mutant line had an average body length of 968.6 µm (SE ± 22.98 µm). The 99% confidence intervals for body size of the two lines did not overlap, indicating a statistically significant difference in body length. This suggests that deletion of the RGD motif at position 348 in LON-2 may improve its ability to inhibit BMP signaling, resulting in a shorter body length. The mechanism by which this occurs remains a topic for future investigation, but may happen due to the lack of normal interactions of the RGD motif with integrins and other proteins. Recent research revealing interactions between LON-2 and LIN-17/Frizzled (Saied-Santiago et al.., 2017) could guide future research toward investigating the relationship between the LON-2 RGD domain and Frizzled/Wnt signaling.

Methods

Request a detailed protocol

CRISPR target sites were identified using the CRISPR guide RNA Selection Tool (http://genome.sfu.ca/crispr/) in order to ensure that the desired mutations would be created in lon-2. The first mutant line lon-2(ΔRGD) contains a total deletion of the RGD motif at amino acid position 348 (Figure A). The second mutant line lon-2(e678) is a reference allele that has not yet been sequenced, but contains a large ~9kb deletion that removes significant portions of the genomic coding sequence in lon-2 (Gumienny et al., 2007). The syncytial gonad arms of N2 wild-type worms (P0) were micro-injected with a mixture containing custom template DNA (Temp-4LON2ΔRGD, Figure A), custom crRNA (LON2RGD350), tracrRNA (cat. #1072532), and Alt-R Cas9 nuclease (cat. #1081058) that had been annealed at room temperature (Mello et al., 1991; Paix et al.., 2015). Primers, repair template, sgRNA and Cas9 enzymes were purchased from IDTDNA Inc., Coralville, IA. F1 worms were then isolated and PCR screened using the mutant specific primer (LON2ΔRGD350F) to ensure that the desired mutation had been induced. Both wild-type (LON2RGD350WTF) and mutant specific (LON2ΔRGD350F) primers were then used in PCR screening of the F2 offspring in order to isolate homozygous mutants. The PCR products were then sequenced to confirm that the mutant allele had been successfully created (Psomagen Inc, Rockville, MD). Both mutant lines were backcrossed (2 times) to N2 and the novel RGD mutant line was then studied to characterize phenotype. 45 wild-type and 27 lon-2(ΔRGD) animals were imaged and measured to screen for the presence of the long phenotype. Worms were first paralyzed using 10 mM levamisole and were then examined under Nomarski optics using a Nikon NiU epifluorescence microscope (Nikon, Melville, NY). The Nikon Element software was then used to digitally measure the body lengths. Results from this assay were then analyzed using a Mann-Whitney U Test in order to obtain quantitative measures of statistical significance.

crRNA sequence

LON2RGD350: ACAGAAACTGACCTCTCTCA

PCR primers

LON2RGD350WTF: CCGAGGAGACGGAGCCGTGA

LON2ΔRGD350F: CTTTTGTGTCGGGTGCTGTCC

LON2RGD350SEQF: CCGACCCCTTTCCTCATGATT

LON2RGD350SEQR: TCAAATCCGCCAAATCAGGCT

Reagents

lon-2(kq348), referred to as lon-2(ΔRGD),  is available upon request.

Acknowledgments

This study was conducted during the course of BIO 3V90 at Baylor University.

References

Gumienny TL, MacNeil LT, Wang H, de Bono M, Wrana JL, Padgett RW. 2007. Glypican LON-2 is a conserved negative regulator of BMP-like signaling in Caenorhabditis elegans. Curr Biol 17: 159-64.
PubMed
Lee M, Shen B, Schwarzbauer JE, Ahn J, Kwon J. 2005. Connections between integrins and Rac GTPase pathways control gonad formation and function in C. elegans. Biochim Biophys Acta 1723: 248-55.
PubMed
Margadant C, Sonnenberg A. 2010. Integrin-TGF-beta crosstalk in fibrosis, cancer and wound healing. EMBO Rep 11: 97-105.
PubMed
Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J 10: 3959-70.
PubMed
Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics 201: 47-54.
PubMed
Saied-Santiago K, Townley RA, Attonito JD, et al. Coordination of Heparan Sulfate Proteoglycans with Wnt Signaling To Control Cellular Migrations and Positioning in Caenorhabditis elegans. Genetics. 2017;206(4):1951-1967.
PubMed
Suzuki Y, Yandell MD, Roy PJ, Krishna S, Savage-Dunn C, Ross RM, Padgett RW, Wood WB. 1999. A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans. Development 126: 241-50.
PubMed
Taneja-Bageshwar S, Gumienny TL. 2012. Two functional domains in C. elegans glypican LON-2 can independently inhibit BMP-like signaling. Dev Biol 371: 66-76.
PubMed

Funding

Funding for BIO 3V90 is provided by Baylor University

Author Contributions

Aileen Park: Investigation, Validation, Writing - original draft
Zhongqiang Qiu: Conceptualization, Investigation, Validation, Methodology
Myeongwoo Lee: Writing - review and editing, Funding acquisition, Methodology.

Reviewed By

Tina Gumienny

History

Received: February 9, 2021
Revision received: March 3, 2021
Accepted: March 8, 2021
Published: March 10, 2021

Copyright

© 2021 by the authors. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Park, A; Qiu, Z; Lee, M (2021). Deletion of the RGD motif in LON-2/glypican is associated with morphological abnormalities. microPublication Biology. 10.17912/micropub.biology.000376.
Download: RIS BibTeX
microPublication Biology is published by
1200 E. California Blvd. MC 1-43 Pasadena, CA 91125
The microPublication project is supported by
The National Institute of Health -- Grant #: 1U01LM012672-01
microPublication Biology:ISSN: 2578-9430