Figure 1. A. Map of exons, introns and the 3’UTR of cls-2 (R107.6). B. The eighth exon and 3’UTR of cls-2 (R107.6) with the position of the xc3, xc4, and xc5 mutations indicated in red. C. Alignment of DNA and amino acid sequences in mutant and wildtype worms with mutations in red.
\n","imageTitle":"","methods":null,"reagents":"Alt-R® CRISPR-Cas9 crRNA
\nAlt-R® CRISPR-Cas9 tracrRNA
\nAlt-R® S.p. Cas9 Nuclease
Strains:
\nXC125 cls-2 (xc3) unc-119 (ed3) III; ieSi38 (IV)
\nXC126 cls-2 (xc4) unc-119 (ed3) III; ieSi38 (IV)
\nXC127 cls-2 (xc5) unc-119 (ed3) III; ieSi38 (IV)
We have generated novel mutant alleles, named xc3, xc4, and xc5, of the gene cls-2 (R107.6) that encode one of the three predicted orthologs of mammalian CLASPs and of Drosophila ORBIT/MAST, microtuble-binding proteins (Akhmanova et al., 2001; Maiato et al., 2002). In C. elegans CLS-2 is required for meiosis and mitosis (Cheeseman et al., 2005; Dumont et al., 2010; Espiritu et al., 2012; Maton et al., 2015; Nahaboo et al., 2015). The alleles were isolated from gene mutations generated by Non-Homologous End Joining (NHEJ) mediated repair of Cas9-generated breaks (Dickinson et al., 2013; Ran et al., 2013). The alleles were detected by PCR using the following primers, 5’- CGATACGTCGGAGCAGAGC -3’ and 5’- CGGGGGTCGAAAATCATAAGG -3’. Next Generation Sequencing allowed us to identify 30 bp flanking sequences of the alleles xc3, xc4, and xc5 as TTGTCCAAGTCTACGTCAATCGGGCAATGT – [42 bp deletion] – AGCCCATAATTCCCCCGTATTCGTATCCCA, TCTACGTCAATCGGGCAATGTCGTCCAGTT – [3 bp deletion, 41 bp insertion (GGTCTGAATGACTTTCGCACTATTCCCCTATTCGCACGCCT)] – ATTCGCACGTATGATTCGTCGTTGCAATGT, and AACCTTGTCCAAGTCTACGTCAATCGGGCA – [111 bp deletion ] – TCATCCCTTCACTTTGTAATATAATTTTAT, respectively.
\nBased on information about cls-2 (R107.6) (WormBase, http://www.wormbase.org, WS261), the xc3, xc4, and xc5 mutant alleles effect the eighth exon and the 3’-UTR in the same way in each splicing isoform (Fig.1). In the xc3 mutant, 16 bp of the 3’UTR is deleted and a new stop codon was introduced after an 8 amino acid deletion (SSSSHSHV) of the C-terminus of the protein. In xc4 due to an insertion causing a frameshift mutation, 5 wildtype amino acids (SHSHV) from the C-terminus will be replaced by 3 amino acids (WSE). In xc5 the endogenous stop codon is deleted as well as 81 bp of the 3’UTR, while a new stop codon is introduced 21 bp after the mutation. Because of the deletion and new stop codon, in the xc5 mutant 9 amino acids (MSSSSHSHV) in the C-terminus of the protein will be replaced by 7 new amino acids (SSLHFVI). Previous researchers replaced serine residues with non-phosphorylatable alanine residues to study the effect of human CLASP2 phosphorylation (Kumar et al., 2017). The mutations we have generated have multiple serine residues deleted which presents a unique opportunity to study the effect of cls-2 (R107.6) phosphorylation. Since more of the 3’UTR is deleted in xc5 than xc3, the 3’UTR’s function could also be studied using these mutants.
\n","references":[{"reference":"Akhmanova, A., Hoogenraad, CC., Drabek, K., Stepanova, T., Dortland, B., Verkerk, T., Vermeulen, W., Burgering, B. M., Zeeuw, D., Grosveld, F., & Galjart, N. (2001). Clasps are CLIP-115 and -170 associating proteins involved in the regional regulation of microtubule dynamics in motile fibroblasts. Cell, 104, 923-35. ","pubmedId":"11290329","doi":"10.1016/S0092-8674(01)00288-4"},{"reference":"Cheeseman, IM., MacLeod, I., Yates, JR., Oegema, K., & Desai, A. (2005). The CENP-F-like proteins HCP-1 and HCP-2 Target CLASP to Kinetochores to Mediate Chromosome Segregation. Current Biology, 15, 771-777.","pubmedId":"15854912","doi":"10.1016/j.cub.2005.03.018"},{"reference":"Dickinson, DJ., Ward, JD., Reiner, DJ., & Goldstein, B. (2013). Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nature Methods 10, 1028-1034.","pubmedId":"23995389","doi":"10.1038/nmeth.2641"},{"reference":"Dumont, J., Oegema, K., & Desai, A. (2010). A kinetochore-independent mechanism drives anaphase chromosome separation during acentrosomal meiosis. Nature Cell Biology 12, 894-901.","pubmedId":"20729837","doi":"10.1038/ncb2093"},{"reference":"Espiritu, EB., Krueger, LE., Ye, A., & Rose, LS. (2012). CLASPs function redundantly to regulate astral microtubules in the C. elegans embryo. Elsevier, 368, 242-254. ","pubmedId":"22613359","doi":"10.1016/j.ydbio.2012.05.016"},{"reference":"Kumar, P., Lyle, KS., Gierke, S., Matov, A., Danuser, G., & Wittmann, T. (2017). GSK3β phosphorylation modulates CLASP-microtubule association and lamella microtuble attachment. J Cell Biol, 184, 895-908.","pubmedId":"19289791","doi":"10.183/jcb.200901042"},{"reference":"Maiato, H., Sampaio, P., Lemos, CL., Findlay, J., Carmena, M., Earnshaw, WC., & Sunkel, CE. (2002). MAST/Orbit has a role in microtubule-kinetochore attachment and is essential for chromosome alignment and maintenance of spindle bipolarity.. J Cell Biol, 157, 749-60.","pubmedId":"12034769","doi":"10.1083/jcb.200201101"},{"reference":"Maton, G., Edwards, F., Lacroix, B., Stefanutti, M., Laband, K., Lieury, T., Kim, T., Espeut, J., Canman, JC., & Dumont, J. (2015). Kinetochore components are required for central spindle assembly. Nature Cell Biology 17, 697-705.","pubmedId":"25866924","doi":"10.1038/ncb3150"},{"reference":"Nahaboo, W., Melissa, Z., Askjaer, P., & Delattre, M. (2015). Chromatids segregate without centrosomes during Caenorhabditis elegans mitosis in a Ran- and CLASP-dependent manner. MBoC 26, 2020-2029. ","pubmedId":"25833711","doi":"10.1091/mbc.e14-12-1577"},{"reference":"Ran, FA., Hsu, PD., Wright, W., Agarwala, V., Scott, D., & Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nature News, 2281-2308. ","pubmedId":"24157548","doi":"10.1038/nprot.2013.143"}],"title":"New alleles of C. elegans gene cls-2 (R107.6), called xc3, xc4, and xc5","reviews":[{"reviewer":{"displayName":"Andrea Kalis"},"openAcknowledgement":true,"status":{"submitted":true}}]}]}}},"pageContext":{"id":"9d0c94a6-cfa8-44c3-af52-6ce435610ce4"}}, "staticQueryHashes": ["1993668605"]}