Mutations in the melanized (mel) gene of Drosophila melanogaster display darker body pigmentation and an enhanced trident pattern on the notum. By complementation, we localized the gene underlying mel to CG17065, which encodes an N-acetylglucosamine-6-phosphate deacetylase. We find that mel1 is a missense mutation in a ligand-binding amino acid and that mel1 fails to complement a protein trap allele of CG17065. Using this allele, we find mel/CG17065 is ubiquitously expressed across larval and ovariole tissues. N-acetylglucosamine-6-phosphate deacetylase is predicted to act as an antagonist to the production of UDP-GlcNAc, the precursor for chitin biosynthesis and O- and N-linked glycosylation.
","acknowledgements":"We would like to thank the Bloomington Drosophila Stock Center for providing fly stocks and FlyBase.org for the detailed descriptions of the history of melanized and the hexosamine biosynthetic pathway. We would also like to thank the Spring 2017 Bio414LS class for preliminary mapping of melanized.
","authors":[{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["writing_originalDraft","investigation","formalAnalysis"],"email":"mayaaschandar01@gmail.com","firstName":"Maya ","lastName":"Chandar","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"emilymariaharc@gmail.com","firstName":"Emily","lastName":"Harclerode","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"elizabethgracekim@gmail.com","firstName":"Elizabeth","lastName":"Kim","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"jasmine.marsh@duke.edu","firstName":"Jasmine J. S. ","lastName":"Marsh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"a.dollymm@gmail.com","firstName":"Adolya ","lastName":"Moore","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0005-2339-1395"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"william.moragne@duke.edu","firstName":"William E. ","lastName":"Moragne III","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"danira.mukhamedyarova@duke.edu","firstName":"Danira R. ","lastName":"Mukhamedyarova","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0007-5425-5462 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ishaan.narsinghani@duke.edu","firstName":"Ishaan ","lastName":"Narsinghani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-1394-0304"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"cody.powell@icloud.com","firstName":"Cody J. ","lastName":"Powell","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ryann.pryor@duke.edu","firstName":"RyAnn ","lastName":"Pryor","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"radicalsubramani@gmail.com","firstName":"Radhika ","lastName":"Subramani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0003-2967-8640"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"blazekgregory@gmail.com","firstName":"Gregory M. ","lastName":"Blazek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-0763-2831"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"kaela.chan3@gmail.com","firstName":"Mikaela Inessa ","lastName":"Chandra","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-9624-8515"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"arjunramesh231@gmail.com","firstName":"Arjun ","lastName":"Ramesh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"stephanie.fogerson@gmail.com","firstName":"Stephanie M. ","lastName":"Fogerson","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"tania.guerrero@duke.edu","firstName":"Tania ","lastName":"Guerrero-Altamirano","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3808-9103 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","methodology","project","supervision","visualization","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"spana@duke.edu","firstName":"Eric P","lastName":"Spana","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2057-8278"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"We would like to thank Duke University Trinity College of Arts and Sciences and the Department of Biology for funding the Biology 414LS course in which this work was performed.
","image":{"url":"https://portal.micropublication.org/uploads/6deec3771ea100e09567902e1c402eb7.png"},"imageCaption":"(A) Wild type (OreR) D. melanogaster female shows normal pigmentation. (B) A female of the genotype mel1 mal1 shows a slightly darker body and pronounced trident pattern due to mel1 and dull-colored eyes due to mal1. (C) A female of the genotype mel1 mal1/Df(1)BSC644 shows the same pigmentation as mel1 mal1 homozygotes. (D) A female of the genotype mel1 mal1/ CG17065CR has the same pigmentation phenotype as B and C. (E-H) Decapitated heads of the same genotypes as A-D shows the hypermelanized region in the ocellar region and near the interorbital bristles (especially F & H). (I) An approximately 75kb region of the X chromosome shows the overlap of the two duplications (light blue) that rescue mel1. Dp(1;3)DC374 extends off the map on the right, and Dp(1:3)DC554 extends off the map to the left. Five protein coding genes: Rab10, CG42577, Inx6, & CG1504 in dark blue and CG17065 in purple, and two non-coding RNA genes (CR45504, CR45505 in orange) lie within this region. Arrowheads indicate the four CR alleles used for complementation. (J) The melanized/CG17065 gene consists of three splice isoforms. The mel1 mutation is shown in red. The CG17065CR allele would terminate translation of the gene after exon 1. The CG17065EY insertion is found in the 5’UTR of all three isoforms. (K) A close-up view of the binding site of the human ortholog of mel/CG17065 (AMDHD2) bound to N-glucosamine-6-phosphate (green outline). The histidine sidechain (red outline) makes a hydrogen bond to the C-1 hydroxyl group of the glucosamine ring. This histidine is mutated to leucine in mel1. (L-M) Expression of mel/CG17065 as visualized by the GAL4 found in the CG17065CR insertion. Red is the expression of UAS-mCherry-NLS, blue is DAPI stained nuclei, and green is phalloidin. The merge of all three colors is shown in the fourth column. Scale bar is 100 μm. (L) mCherry-NLS is expressed in all the nuclei of the larval salivary gland (arrowhead) and associated fat body (arrow) at 200X. (M) mCherry-NLS is expressed in all nuclei of the larval midgut at 200X. (N) mCherry-NLS is expressed in both cell types of the larval Malpighian Tubule: the Stellate cells (arrow) and Principal cells (arrowhead) at 400X. (O) mCherry-NLS is expressed in all follicle cells in this Stage 9 egg chamber at 200X.
","imageTitle":"D. melanogaster melanized (mel) maps to CG17065 and is ubiquitously expressed
","methods":"Fly Imaging: To image adult flies, 5-10 day old females were anesthetized using FlyNap (Carolina Biological Supply Company) by placing a saturated FlyNap swab in the food vial for 2-5 minutes which allowed immobilization and was verified by tapping. Excess product was removed to ensure survival. Once anesthetized, flies were transferred to a white surface for optimal visibility and oriented with their dorsal side up. A Leica MZ12.5 stereomicroscope equipped with a Nikon D300S camera was adjusted to 50x magnification, and the camera was focused on the notum while keeping wings and legs in view. A hollow printer-paper cylinder (~2.5 cm diameter, ~2.5 cm high) was placed around the specimen to reduce ring-light reflection on the thorax while maintaining clear visualization of the fly in its natural position. This protocol is based on some of the methods seen here: http://gompel.org/wp-content/uploads/2015/09/Depth_of_field_Drosophila-photography.pdf
To image heads, females were anesthetized with CO₂. The heads were removed from the bodies using a razor blade and positioned on the end of a wooden toothpick (GoodCook Everyday Shake-A-Pick toothpick) and adhered with L.A. Colors clear topcoat nail polish. Once secure, the toothpick was positioned on a ~1 cm3 piece of modeling clay so that the dorsal side of the head was up. The total magnification was set to 63x and focused on the orbital bristle region to visualize the hyperpigmented patches. The heads were photographed above a BEHR paint swatch (Bluebird PPU15-12M, Home Depot) for optimal visibility.
Genomic DNA isolation from Drosophila: Genomic DNA was isolated from OreR, mel1mal1, and w1118 CG17065CR flies using Qiagen’s DNeasy Blood and Tissue kit (Cat no. / ID. 69504) and stored at -20ºC after isolation. For amplifying the CG17065EY region we used a squishing buffer prep (Gloor, 1992).
PCR & Sequencing: We used the genome sequence (r6.65) available on FlyBase and Primer3Plus (primer3plus.com) to design primers. Primers used to amplify the entire CG17065 locus and verify the EY insertion are listed in reagents. We performed PCR using the UltraRun LongRange PCR Kit (QIAGEN). PCR products were sequenced by Plasmidsaurus.
Larvae/Ovariole staining: Wandering third instar larvae were dissected under PBS by tearing at the halfway point, and then inverting both the anterior and posterior ends. Mature female ovarioles were dissected by placing the female under PBS and removing the posterior end with ovarioles still attached. Dissected tissue was fixed for 30 minutes in PBS+4% paraformaldehyde. After fixation, the tissue was briefly rinsed 3 times with PBS+0.1% Triton X-100 (PBS+T), and then washed for 30 minutes in the same. Tissue was then stained by incubation with 1 µg/ml DAPI and 1:500 Alexa Fluor 488-Phalloidin for 30 minutes. After 3 brief washes in PBS+T, tissue was mounted in Vectashield+DAPI.
","reagents":"Reagent Type | Designation | Identifier | Reference/Source | Additional Information |
Genetic reagent (D. melanogaster) | OreR | N/A | Lab strain | Genotype: OreR |
Genetic reagent (D. melanogaster) | mel1mal1 | Derived from BDSC 3973 | Bloomington Drosophila Stock Center | Genotype: mel1mal1 Derived from y1 v1 mel1mal1 by recombination with OreR |
Genetic reagent (D. melanogaster) | CG17065CR | Derived from BDSC 93959 | Bloomington Drosophila Stock Center | Genotype: w1118 CG17065CR60133-TG4.1 Derived from y* w* CG17065CR60133-TG4.1 by recombination with w1118 |
Genetic reagent (D. melanogaster) | Rab10CR | BDSC 605429 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.1}Rab10CR71289-TG4.1 |
Genetic reagent (D. melanogaster) | Inx6CR | BDSC 600096 | Bloomington Drosophila Stock Center | y1 w* TI{KozakGAL4}Inx6CR70789-KO-kG4 |
Genetic reagent (D. melanogaster) | CG1504CR | BDSC 93929 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.0}CG1504CR02588-TG4.0 |
Genetic reagent (D. melanogaster) | CG17065EY | BDSC 16381 | Bloomington Drosophila Stock Center | y1 w67c23 P{EPgy2}CG17065EY06065 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC374 | BDSC 32282 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC374 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC554 | BDSC 33505 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC554/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC556 | BDSC 33506 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC556/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1:3)DC371 | BDSC 32281 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC371 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC553 | BDSC 33504 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC553/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC409 | BDSC 30799 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC409 |
Genetic reagent (D. melanogaster) | Df(1)HM44 | BDSC 6279 | Bloomington Drosophila Stock Center | Genotype: Df(1)HM44, y1 wa/ Dp(1;Y)y+ mal+ |
Genetic reagent (D. melanogaster) | Df(1)BSC644 | BDSC 25734 | Bloomington Drosophila Stock Center | Genotype: Df(1)BSC644 w1118 / Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC872 | BDSC 29995 | Bloomington Drosophila Stock Center | Df(1)BSC872, w1118 BSC872/FM7h/Dp(2;Y)G, P{hs-hid}Y |
Genetic reagent (D. melanogaster) | Df(1)BSC586 | BDSC 25420 | Bloomington Drosophila Stock Center | Df(1)BSC586, w1118/Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC648 | BDSC 25738 | Bloomington Drosophila Stock Center | Df(1)BSC648, w1118/FM7h/Dp(2;Y)G, P{w+mC=hs-hid}Y |
Genetic reagent (D. melanogaster) | UAS-mCherry.nls | BDSC 38424 | Bloomington Drosophila Stock Center | w*; P{w+, UAS-mCherry.NLS}3 |
Chemical | FlyNap | Carolina Biological Supply Company | ||
Chemical | Vectashield + DAPI | H-1200 | Vector Laboratories, Burlingame | |
Chemical | Alexa Fluor 488-Phalloidin | A12379 | Invitrogen | |
Software | Protein Data Bank | N/A | https://www.rcsb.org/ | |
PCR Kit | UltraRun LongRange PCR Kit | Cat no. / ID. 206442 | QIAGEN | |
Oligonucleotide | CG17065.CP-F primer | TAGCATTCGCATTTGCATTCG | Eton Bio | |
Oligonucleotide | CG17065.CP-R primer | GCACTGGAATTGGTTTCTCAGT | Eton Bio | |
Oligonucleotide | CG17065.EY-R primer | GTCGGGGGTGGCGCAAGG | Eton Bio | |
Oligonucleotide | CG17065.EY-F primer | TCTGGCTCCTCGCTGTTG | Eton Bio | |
Oligonucleotide | P-end primer | CGACGGGACCACCTTATGTTATTTCATCATG | Eton Bio |
The body color of the adult Drosophila melanogaster is produced through a combination of melanin and two sclerotization pathways, all of which are derived from dopamine (Wright, 1987). Dopamine is synthesized from tyrosine via Tyrosine Hydroxylase (encoded by the pale gene) and Dopa Decarboxylase (encoded by the Ddc gene) (reviewed in Yamamoto & Seto, 2014). That dopamine pool can be used by several pathways: it can be converted to melanin via the genes yellow, yellow-f, straw, and others (Han et al., 2002; Riedel et al., 2011; Sickmann et al., 2017); it can be converted to N-acetyldopamine (via the speck gene) for incorporation into NADA sclerotin (Spana et al.), or it can be combined with beta-alanine (by the ebony gene) to make NBAD sclerotin (Richardt et al.). A recent RNAi screen identified over 100 genes autonomously required for adult pigmentation (Deal et al.). However, because of its rich research history, there are still viable strains of D. melanogaster available with body color defects that are unannotated or recently de-orphaned (Dean et al.). Here we map the melanized (mel) gene via genetic complementation, and document its phenotype and expression.
Alleles of the mel gene have been isolated twice (mel1 and mel2) (Fahmy, O.G., Fahmy, M., 1958), however mel2 has been lost. mel1 has been described as having a darker body color and an especially prominent ‘trident’ on the thorax as well as dull red eyes and occasional upturned wings. It has been mapped genetically to 1-64.1 (Fahmy, O.G., Fahmy, M., 1958) and cytologically to 19B-C (Chovnick et al.). We could use complementation testing examining the body color, but not the wing phenotype (not penetrant enough) or eye color (the mel1 chromosome also carries a closely-linked eye color mutation, maroon-like, mal1).
We first confirmed the phenotype of the mel1 allele. As expected, when compared to wild type OregonR (Figure 1A) mel1 had a dark trident and darker body color (Figure 1B). Additionally, the melanized phenotype was prominently displayed in the ocular ridge around the eyes (Figure 1E, F). Next, to map mel1, we performed a series of complementation tests using deficiency and duplication stocks (abbreviated Df and Dp, respectively) to localize the mutation. We found that mel failed to complement Df(1)HM44 exactly as described in 1986 (Miklos et al., 1986). We then tested five molecularly defined deficiency strains: Df(1)ED7635, Df(1)BSC644, Df(1)BSC872, Df(1)BSC648, and Df(1)BSC586 that span from 19A1 to 19E7. Of these, only Df(1)ED7635 complemented mel. That places mel between the left breakpoint of Df(1)BSC644 and the right breakpoint of Df(1)BSC872: the 19C1-4 range. When in trans to mel1, Df(1)BSC644 fails to complement and shows the same mel phenotype as mel1 homozygotes, indicating that mel1 is likely a strong, if not null, allele (Figure 1C, G). To further refine this mapping, we found that, when crossed with mel1, Dp(1;3)DC374 and Dp(1;3)DC554 rescue the wild-type pigmentation, while Dp(1;3)DC553; Dp(1;3)DC556; and Dp(1;3)DC409 do not. Taken together, these complementation results localized the mel locus to the ~72 kb region between positions 20,250,237–20,322,155, which contains five candidate protein coding genes: Inx6, Rab10, CG1504, CG42577, and CG17065 (Figure 1I). Mutations in four of these genes were individually tested by complementation with mel1. Only an allele of CG17065, CG17065CR, failed to complement mel¹ (Figure 1D, H). Further, flies homozygous for the CG17065CR mutation had the same dark body and trident phenotype as mel1. These data gave us a strong inclination that mel1 was a mutation in the CG17065 gene, and to test this, we amplified and sequenced CG17065 from wild-type OreR and mel1 flies. We found a single base change that causes a mis-sense mutation: histidine to leucine at amino acid 283 (Figure 1J). A second insertion in CG17065 (CG17065EY) was found to complement both mel1 and CG17065CR. The CG17065EY insertion is located in the 5’ UTR of all three splice isoforms; however, it does have a basal promoter and UAS sequences that would facilitate transcription of the CG17065 gene. Attempted mis/overexpression of CG17065 by crossing CG17065EY to different GAL4 drivers showed no pigmentation phenotypes or viability issues. Because CG17065CR has a melanized phenotype and fails to complement mel1, and mel1 has a missense mutation in CG17065, we conclude that CG17065 is the melanized gene. CG17065 encodes N-acetylglucosamine-6-phosphate deacetylase (abbreviated hereafter as GlcNAc-6-P deacetylase).
To understand how a single amino-acid substitution could generate such a pronounced loss of function, we examined the position of the H283L mutation within the GlcNAc-6-P deacetylase structure. We used the model for the human ortholog of GlcNAc-6-P deacetylase (called AMDHD2) because it had a structure available that included the bound ligand (https://doi.org/10.2210/pdb7NUT/pdb) (Kroef et al.). From this, we found that Histidine 283 (Histidine 272 in human ortholog) lies in close proximity to the bound substrate, N-acetylglucosamine-6-phosphate (Figure 1K). In the wild-type protein, the imidazole side chain of Histidine 283 is positioned to form a stabilizing hydrogen bond with the O atom of the C1-hydroxyl group of the ligand, likely contributing to the proper orientation and affinity of substrate binding. Substituting histidine with leucine eliminates this polar, hydrogen-bonding-capable residue and introduces a hydrophobic side chain into an otherwise polar microenvironment. This change would then disrupt favorable electrostatic and hydrogen-bonding interactions and alter the geometry of the ligand-binding pocket, thereby reducing substrate affinity and reducing GlcNAc-6-P deacetylase activity.
To assess GlcNAc-6-P deacetylase expression across tissue types, we utilized the CG17065CR allele. This CRISPR insertion is a CRIMIC insertion that traps and truncates the mel/CG17065 transcript and initiates expression of GAL4 from mel/CG17065 mRNA (Kanca et al.). Crossing this GAL4 line to a UAS-mCherry-NLS will reproduce the mel/CG17065 expression pattern. A colocalization approach involving Phalloidin and DAPI fluorescent staining was additionally used to visualize F-actin and nuclei staining, respectively. Here, we see near ubiquitous expression across Drosophila tissues. We see notable expression in the salivary gland nuclei (arrowhead in Figure 1L) as well as associated fat body cells (arrow). We see expression in the midgut (Figure 1M), and both cell types in Malpighian tubules: Stellate cells (arrow) and Principal cells (arrowhead in Figure 1N). We see expression in ovarian follicle cells as seen in this stage 9 egg chamber (Figure 1O).
How might a loss of function in GlcNAc-6-P deacetylase cause the pigmentation phenotype found in melanized? It is known that GlcNAc-6-P deacetylase, an enzyme involved in the hexosamine biosynthesis pathway, is responsible for the deacetylation of N-acetylglucosamine-6-phosphate (GlcNAc‑6‑P) to glucosamine-6-phosphate (Glc-6-P) (Paneque et al.). GlcNAc-6-P is two enzymatic steps from UDP-GlcNAc, which is the starting material for both O- and N-linked glycosylation, as well as chitin formation. It is possible that the loss of GlcNAc-6-P deacetylase might cause an excess of GlcNAc-6-P, and thus an excess UDP-GlcNAc. Because UDP-GlcNAc is such a keystone molecule in multiple pathways, there is no shortage of potential mechanisms: Tyrosine Hydroxylase is regulated by O-linked glycosylation (da Costa Rodrigues et al.); in Drosophila, loss of warts causes excess pigmentation (Gibson et al.), and its human ortholog LATS1 is regulated by O-linked glycosylation (Meng et al.); and a different enzyme in the hexosamine biosynthesis pathway is required for mouse and human hair pigmentation (Tiede et al.). Future experiments with melanized in the melanin pathway, the protein glycosylation pathways, and the chitin biosynthesis pathways should provide answers.
","references":[{"reference":"Chovnick A, Finnerty V, Schalet A, Duck P. 1969. STUDIES ON GENETIC ORGANIZATION IN HIGHER ORGANISMS: I. ANALYSIS OF A COMPLEX GENE IN DROSOPHILA MELANOGASTER. Genetics 62: 145-160.
","pubmedId":"","doi":"10.1093/genetics/62.1.145"},{"reference":"da Costa Rodrigues B, dos Santos Lucena MC, Costa ACR, de Araújo Oliveira I, Thaumaturgo M, Paes-Colli Y, et al., Dias. 2025. O-GlcNAcylation regulates tyrosine hydroxylase serine 40 phosphorylation and
Deal SL, Bei D, Gibson SB, Delgado-Seo H, Fujita Y, Wilwayco K, et al., Yamamoto. 2026. RNAi-based screen for pigmentation in Drosophila melanogaster reveals regulators of brain dopamine and sleep. iScience 29: 114388.
","pubmedId":"","doi":"10.1016/j.isci.2025.114388"},{"reference":"Dean DM, Deitcher DL, Paster CO, Xu M, Loehlin DW. 2022. “A fly appeared”: sable, a classic Drosophila mutation, maps to Yippee, a gene affecting body color, wings, and bristles. G3 Genes|Genomes|Genetics 12: 10.1093/g3journal/jkac058.
","pubmedId":"","doi":"10.1093/g3journal/jkac058"},{"reference":"Fahmy, O.G., Fahmy, M. 1958. New mutants report. Drosophila Information Service 32: 67–78.
","pubmedId":"","doi":""},{"reference":"Gibson SB, Deal SL, Park YJ, Sun B, Qi Y, Mok JW, et al., Yamamoto. 2025. Hippo signaling regulates cuticle pigmentation and dopamine metabolism in\n Drosophila. : 10.1101/2025.11.13.688152.
","pubmedId":"","doi":"10.1101/2025.11.13.688152"},{"reference":"Gloor, G., Engels, W. 1992. Single-fly DNA preps for PCR. Drosophila Information Service 71: 148–149.
","pubmedId":"","doi":""},{"reference":"HAN Q, FANG J, DING H, JOHNSON JK, CHRISTENSEN BM, LI J. 2002. Identification of Drosophila melanogaster yellow-f and yellow-f2 proteins as dopachrome-conversion enzymes. Biochemical Journal 368: 333-340.
","pubmedId":"","doi":"10.1042/BJ20020272"},{"reference":"Kanca O, Zirin J, Hu Y, Tepe B, Dutta D, Lin WW, et al., Bellen. 2022. An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination. eLife 11: 10.7554/elife.76077.
","pubmedId":"","doi":"10.7554/eLife.76077"},{"reference":"Kroef V, Ruegenberg S, Horn M, Allmeroth K, Ebert L, Bozkus S, et al., Denzel. 2022. GFPT2/GFAT2 and AMDHD2 act in tandem to control the hexosamine pathway. eLife 11: 10.7554/elife.69223.
","pubmedId":"","doi":"10.7554/eLife.69223"},{"reference":"Meng L, Wang Y, Zhou W, Wu S, Li J. 2026. O-GlcNAcylation of the tumor suppressor LATS1 drives mitotic progression via PLK1. Journal of Biological Chemistry 302: 110990.
","pubmedId":"","doi":"10.1016/j.jbc.2025.110990"},{"reference":"Miklos, G. L. G., Kramers, P. G. N., & Schalet, A. P. 1986. The proximal-distal orientation of two lethal complementation groups A112 and LB20 in region 19F at the base of the X chromosome. Drosophila Information Service 63: 96–97.
","pubmedId":"","doi":""},{"reference":"Paneque A, Fortus H, Zheng J, Werlen G, Jacinto E. 2023. The Hexosamine Biosynthesis Pathway: Regulation and Function. Genes 14: 933.
","pubmedId":"","doi":"10.3390/genes14040933"},{"reference":"Richardt A, Kemme T, Wagner S, Schwarzer D, Marahiel MA, Hovemann BT. 2003. Ebony, a Novel Nonribosomal Peptide Synthetase for β-Alanine Conjugation with Biogenic Amines in Drosophila. Journal of Biological Chemistry 278: 41160-41166.
","pubmedId":"","doi":"10.1074/jbc.M304303200"},{"reference":"Riedel F, Vorkel D, Eaton S. 2011. Megalin-dependent Yellow endocytosis restricts melanization in theDrosophilacuticle. Development 138: 149-158.
","pubmedId":"","doi":"10.1242/dev.056309"},{"reference":"Sickmann, M., Gohl, D. M., Affolter, M., & Muller, M. 2017. The Drosophila melanogaster straw locus is allelic to laccase2. Drosophila Information Service 100: 171–174.
","pubmedId":"","doi":""},{"reference":"Spana EP, Abrams AB, Ellis KT, Klein JC, Ruderman BT, Shi AH, et al., May. 2020. speck\n , First Identified in\n Drosophila melanogaster\n in 1910, Is Encoded by the Arylalkalamine N-Acetyltransferase (AANAT1) Gene. G3 Genes|Genomes|Genetics 10: 3387-3398.
","pubmedId":"","doi":"10.1534/g3.120.401470"},{"reference":"Tiede S, Hundt JE, Paus R. 2021. UDP-GlcNAc-1-Phosphotransferase Is a Clinically Important Regulator of Human and Mouse Hair Pigmentation. Journal of Investigative Dermatology 141: 2957-2965.e5.
","pubmedId":"","doi":"10.1016/j.jid.2021.04.028"},{"reference":"Wright TRF. 1987. The Genetics Of Biogenic Amine Metabolism, Sclerotization, And Melanization In Drosophila Melanogaster. Advances in Genetics,Molecular Genetics of Development : 127-222.
","pubmedId":"","doi":"//doi.org/10.1016/S0065-2660(08)60008-5"},{"reference":"Yamamoto S, Seto ES. 2014. Dopamine Dynamics and Signaling in <i>Drosophila</i>: An Overview of Genes, Drugs and Behavioral Paradigms. Experimental Animals 63: 107-119.
","pubmedId":"","doi":"10.1538/expanim.63.107"}],"title":"The melanized (mel) locus of Drosophila melanogaster is a mutation in CG17065, an N-acetylglucosamine-6-phosphate deacetylase
","reviews":[{"reviewer":{"displayName":"Derek Dean"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":"1778598418252"}]},{"id":"4b2d8c08-9fb0-403f-9639-2f8243eb0f79","decision":"edit","abstract":"Mutations in the melanized (mel) gene of Drosophila melanogaster display darker body pigmentation and an enhanced trident pattern on the notum. By complementation, we localized the gene underlying mel to CG17065, which encodes an N-acetylglucosamine-6-phosphate deacetylase. We find that mel1 is a missense mutation in a ligand-binding amino acid and that mel1 fails to complement a protein trap allele of CG17065. Using this allele, we find mel/CG17065 is ubiquitously expressed across larval and ovariole tissues. N-acetylglucosamine-6-phosphate deacetylase is predicted to act as an antagonist to the production of UDP-GlcNAc, the precursor for chitin biosynthesis and O- and N-linked glycosylation.
","acknowledgements":"We would like to thank the Bloomington Drosophila Stock Center for providing fly stocks and FlyBase.org for the detailed descriptions of the history of melanized and the hexosamine biosynthetic pathway. We would also like to thank the Spring 2017 Bio414LS class for preliminary mapping of melanized.
","authors":[{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["writing_originalDraft","investigation","formalAnalysis"],"email":"mayaaschandar01@gmail.com","firstName":"Maya ","lastName":"Chandar","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"emilymariaharc@gmail.com","firstName":"Emily","lastName":"Harclerode","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"elizabethgracekim@gmail.com","firstName":"Elizabeth","lastName":"Kim","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"jasmine.marsh@duke.edu","firstName":"Jasmine J. S. ","lastName":"Marsh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"a.dollymm@gmail.com","firstName":"Adolya ","lastName":"Moore","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0005-2339-1395"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"william.moragne@duke.edu","firstName":"William E. ","lastName":"Moragne III","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"danira.mukhamedyarova@duke.edu","firstName":"Danira R. ","lastName":"Mukhamedyarova","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0007-5425-5462 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ishaan.narsinghani@duke.edu","firstName":"Ishaan ","lastName":"Narsinghani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-1394-0304"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"cody.powell@icloud.com","firstName":"Cody J. ","lastName":"Powell","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ryann.pryor@duke.edu","firstName":"RyAnn ","lastName":"Pryor","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"radicalsubramani@gmail.com","firstName":"Radhika ","lastName":"Subramani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0003-2967-8640"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"blazekgregory@gmail.com","firstName":"Gregory M. ","lastName":"Blazek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-0763-2831"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"kaela.chan3@gmail.com","firstName":"Mikaela Inessa ","lastName":"Chandra","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-9624-8515"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"arjunramesh231@gmail.com","firstName":"Arjun ","lastName":"Ramesh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"stephanie.fogerson@gmail.com","firstName":"Stephanie M. ","lastName":"Fogerson","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"tania.guerrero@duke.edu","firstName":"Tania ","lastName":"Guerrero-Altamirano","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3808-9103 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","methodology","project","supervision","visualization","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"spana@duke.edu","firstName":"Eric P","lastName":"Spana","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2057-8278"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"We would like to thank Duke University Trinity College of Arts and Sciences and the Department of Biology for funding the Biology 414LS course in which this work was performed.
","image":{"url":"https://portal.micropublication.org/uploads/6deec3771ea100e09567902e1c402eb7.png"},"imageCaption":"(A) Wild type Oregon-R (OreR) D. melanogaster female shows normal body pigmentation. (B) A female of the genotype mel1 mal1 shows a slightly darker body and pronounced trident pattern due to mel1 and dull-colored eyes due to mal1. (C) A female of the genotype mel1 mal1/Df(1)BSC644 shows the same pigmentation as mel1 mal1 homozygotes. (D) A female of the genotype mel1 mal1/ CG17065CR has the same pigmentation phenotype as B and C. (E-H) Decapitated heads of the same genotypes as A-D shows the hypermelanized region in the ocellar region and near the interorbital bristles (especially F & H). (I) An approximately 75kb region of the X chromosome shows the overlap of the two duplications (light blue) that rescue mel1. Dp(1;3)DC374 extends off the map on the right, and Dp(1:3)DC554 extends off the map to the left. Five protein coding genes: Rab10, CG42577, Inx6, & CG1504 in dark blue and CG17065 in purple, and two non-coding RNA genes (CR45504, CR45505 in orange) lie within this region. Arrowheads indicate the four CR alleles used for complementation. (J) The melanized/CG17065 gene consists of three splice isoforms. The mel1 mutation is shown in red. The CG17065CR allele would terminate translation of the gene after exon 1. The CG17065EY insertion is found in the 5’UTR of all three isoforms. (K) A close-up view of the binding site of the human ortholog of mel/CG17065 (AMDHD2) bound to N-glucosamine-6-phosphate (green outline). The histidine sidechain (red outline) makes a hydrogen bond to the C-1 hydroxyl group of the glucosamine ring. This histidine is mutated to leucine in mel1. (L-M) Expression of mel/CG17065 as visualized by the GAL4 found in the CG17065CR insertion. Red is the expression of UAS-mCherry-NLS, blue is DAPI stained nuclei, and green is phalloidin. The merge of all three colors is shown in the fourth column. Scale bar is 100 μm. (L) mCherry-NLS is expressed in all the nuclei of the larval salivary gland (arrowhead) and associated fat body (arrow) at 200X. (M) mCherry-NLS is expressed in all nuclei of the larval midgut at 200X. (N) mCherry-NLS is expressed in both cell types of the larval Malpighian Tubule: the Stellate cells (arrow) and Principal cells (arrowhead) at 400X. (O) mCherry-NLS is expressed in all follicle cells in this Stage 9 egg chamber at 200X.
","imageTitle":"D. melanogaster melanized (mel) maps to CG17065 and is ubiquitously expressed
","methods":"Fly Imaging: To image adult flies, 5-10 day old females were anesthetized using FlyNap (Carolina Biological Supply Company) by placing a saturated FlyNap swab in the food vial for 2-5 minutes which allowed immobilization and was verified by tapping. Excess product was removed to ensure survival. Once anesthetized, flies were transferred to a white surface for optimal visibility and oriented with their dorsal side up. A Leica MZ12.5 stereomicroscope equipped with a Nikon D300S camera was adjusted to 50x magnification, and the camera was focused on the notum while keeping wings and legs in view. A hollow printer-paper cylinder (~2.5 cm diameter, ~2.5 cm high) was placed around the specimen to reduce ring-light reflection on the thorax while maintaining clear visualization of the fly in its natural position. This protocol is based on some of the methods seen here: http://gompel.org/wp-content/uploads/2015/09/Depth_of_field_Drosophila-photography.pdf
To image heads, females were anesthetized with CO₂. The heads were removed from the bodies using a razor blade and positioned on the end of a wooden toothpick (GoodCook Everyday Shake-A-Pick toothpick) and adhered with L.A. Colors clear topcoat nail polish. Once secure, the toothpick was positioned on a ~1 cm3 piece of modeling clay so that the dorsal side of the head was up. The total magnification was set to 63x and focused on the orbital bristle region to visualize the hyperpigmented patches. The heads were photographed above a BEHR paint swatch (Bluebird PPU15-12M, Home Depot) for optimal visibility.
Genomic DNA isolation from Drosophila: Genomic DNA was isolated from OreR, mel1mal1, and w1118 CG17065CR flies using Qiagen’s DNeasy Blood and Tissue kit (Cat no. / ID. 69504) and stored at -20ºC after isolation. For amplifying the CG17065EY region we used a squishing buffer prep (Gloor, 1992).
PCR & Sequencing: We used the genome sequence (r6.65) available on FlyBase and Primer3Plus (primer3plus.com) to design primers. The CG17065.CP-F and CG17065.CP-R primers were used to amplify the entire CG17065 locus using these conditions: 93° for 3 minutes to activate the polymerase, (93° for 30 seconds, 55° for 15 seconds, 72° for 2.5 minutes) x 35 cycles and a final 10-minute extension at 72°. For the CG17065CR insertion, we increased the extension time to 5 minutes. To verify the EY insertion, we used combinations of the primers: CG17065.EY-F and CG17065.EY-R (genomic primers) and the P-end primer (which is to the P-element inverted terminal repeat and will extend off both ends) under these conditions: 93° for 3 minutes to activate the polymerase, (93° for 30 seconds, 55° for 15 seconds, 72° for 0.5 minutes) x 35 cycles and a final 10-minute extension at 72°. We performed PCR using the UltraRun LongRange PCR Kit (QIAGEN). PCR products were sequenced using Oxford Nanopore technology by Plasmidsaurus.
Larvae/Ovariole staining: Wandering third instar larvae were dissected under PBS by tearing at the halfway point, and then inverting both the anterior and posterior ends. Mature female ovarioles were dissected by placing the female under PBS and removing the posterior end with ovarioles still attached. Dissected tissue was fixed for 30 minutes in PBS+4% paraformaldehyde. After fixation, the tissue was briefly rinsed 3 times with PBS+0.1% Triton X-100 (PBS+T), and then washed for 30 minutes in the same. Tissue was then stained by incubation with 1 µg/ml DAPI and 1:500 Alexa Fluor 488-Phalloidin for 30 minutes. After 3 brief washes in PBS+T, tissue was mounted in Vectashield+DAPI.
","reagents":"Reagent Type | Designation | Identifier | Reference/Source | Additional Information |
Genetic reagent (D. melanogaster) | OreR | N/A | Lab strain | Genotype: OreR |
Genetic reagent (D. melanogaster) | mel1mal1 | Derived from BDSC 3973 | Bloomington Drosophila Stock Center | Genotype: mel1mal1 Derived from y1 v1 mel1mal1 by recombination with OreR |
Genetic reagent (D. melanogaster) | CG17065CR | Derived from BDSC 93959 | Bloomington Drosophila Stock Center | Genotype: w1118 CG17065CR60133-TG4.1 Derived from y* w* CG17065CR60133-TG4.1 by recombination with w1118 |
Genetic reagent (D. melanogaster) | Rab10CR | BDSC 605429 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.1}Rab10CR71289-TG4.1 |
Genetic reagent (D. melanogaster) | Inx6CR | BDSC 600096 | Bloomington Drosophila Stock Center | y1 w* TI{KozakGAL4}Inx6CR70789-KO-kG4 |
Genetic reagent (D. melanogaster) | CG1504CR | BDSC 93929 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.0}CG1504CR02588-TG4.0 |
Genetic reagent (D. melanogaster) | CG17065EY | BDSC 16381 | Bloomington Drosophila Stock Center | y1 w67c23 P{EPgy2}CG17065EY06065 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC374 | BDSC 32282 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC374 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC554 | BDSC 33505 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC554/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC556 | BDSC 33506 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC556/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1:3)DC371 | BDSC 32281 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC371 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC553 | BDSC 33504 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC553/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC409 | BDSC 30799 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC409 |
Genetic reagent (D. melanogaster) | Df(1)HM44 | BDSC 6279 | Bloomington Drosophila Stock Center | Genotype: Df(1)HM44, y1 wa/ Dp(1;Y)y+ mal+ |
Genetic reagent (D. melanogaster) | Df(1)BSC644 | BDSC 25734 | Bloomington Drosophila Stock Center | Genotype: Df(1)BSC644 w1118 / Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC872 | BDSC 29995 | Bloomington Drosophila Stock Center | Df(1)BSC872, w1118 BSC872/FM7h/Dp(2;Y)G, P{hs-hid}Y |
Genetic reagent (D. melanogaster) | Df(1)BSC586 | BDSC 25420 | Bloomington Drosophila Stock Center | Df(1)BSC586, w1118/Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC648 | BDSC 25738 | Bloomington Drosophila Stock Center | Df(1)BSC648, w1118/FM7h/Dp(2;Y)G, P{w+mC=hs-hid}Y |
Genetic reagent (D. melanogaster) | UAS-mCherry.nls | BDSC 38424 | Bloomington Drosophila Stock Center | w*; P{w+, UAS-mCherry.NLS}3 |
Chemical | FlyNap | Carolina Biological Supply Company | ||
Chemical | Vectashield + DAPI | H-1200 | Vector Laboratories, Burlingame | |
Chemical | Alexa Fluor 488-Phalloidin | A12379 | Invitrogen | |
Software | Protein Data Bank | N/A | https://www.rcsb.org/ | |
PCR Kit | UltraRun LongRange PCR Kit | Cat no. / ID. 206442 | QIAGEN | |
Oligonucleotide | CG17065.CP-F primer | TAGCATTCGCATTTGCATTCG | Eton Bio | |
Oligonucleotide | CG17065.CP-R primer | GCACTGGAATTGGTTTCTCAGT | Eton Bio | |
Oligonucleotide | CG17065.EY-R primer | GTCGGGGGTGGCGCAAGG | Eton Bio | |
Oligonucleotide | CG17065.EY-F primer | TCTGGCTCCTCGCTGTTG | Eton Bio | |
Oligonucleotide | P-end primer | CGACGGGACCACCTTATGTTATTTCATCATG | Eton Bio |
The body pigmentation of the adult Drosophila melanogaster is produced through a combination of melanin and two sclerotization pathways, all of which are derived from dopamine (Wright, 1987). Dopamine is synthesized from tyrosine via Tyrosine Hydroxylase (encoded by the pale gene) and Dopa Decarboxylase (encoded by the Ddc gene) (reviewed in Yamamoto & Seto, 2014). That dopamine pool can be used by several pathways: it can be converted to melanin via the genes yellow, yellow-f, straw, and others (Han et al., 2002; Riedel et al., 2011; Sickmann et al., 2017); it can be converted to N-acetyldopamine (via the speck gene) for incorporation into NADA sclerotin (Spana et al., 2020), or it can be combined with beta-alanine (by the ebony gene) to make NBAD sclerotin (Richardt et al., 2003). A recent RNAi screen identified over 100 genes autonomously required for adult pigmentation (Deal et al., 2026). However, because of its rich research history, there are still viable strains of D. melanogaster available with body color defects that are unannotated or recently de-orphaned (Dean et al., 2022). Here we map the melanized (mel) gene via genetic complementation, and document its phenotype and expression.
Alleles of the mel gene have been isolated twice (mel1 and mel2) (Fahmy, O.G., Fahmy, M., 1958), however mel2 has been lost. mel1 has been described as having a darker body color and an especially prominent ‘trident’ on the thorax as well as dull red eyes and occasional upturned wings. It has been mapped genetically to 1-64.1(Fahmy, O.G., Fahmy, M., 1958) and cytologically to 19B-C (Chovnick et al., 1969). Of the three phenotypes associated with mel, we could only use complementation tests by scoring the body color. The wing phenotype was not penetrant enough and we could not distinguish the eye color phenotype (and the mel1 chromosome also carries an eye color mutation, maroon-like, mal1).
We first confirmed the phenotype of the mel1 allele. As expected, when compared to wild type Oregon-R (OreR) (Figure 1A) mel1 had a dark trident and darker body color (Figure 1B). Additionally, the melanized phenotype was prominently displayed in the ocular ridge around the eyes (Figure 1E, F). Next, to map mel1, we performed a series of complementation tests using deficiency and duplication stocks (abbreviated Df and Dp, respectively) to localize the mutation. We found that mel failed to complement Df(1)HM44 exactly as described in 1986 (Miklos et al., 1986) and crosses with wild type Oregon-R showed no dominant effect of mel, no thoracic tridents or darker bodies. We then tested five molecularly defined deficiency strains: Df(1)ED7635, Df(1)BSC644, Df(1)BSC872, Df(1)BSC648, and Df(1)BSC586 that span from 19A1 to 19E7. Of these, only Df(1)ED7635 complemented mel. That places mel between the left breakpoint of Df(1)BSC644 and the right breakpoint of Df(1)BSC872: the 19C1-4 range. When in trans to mel1, Df(1)BSC644 fails to complement and shows the same thoracic mel phenotype as mel1 homozygotes, indicating that mel1 is likely a strong, if not null, allele (Figure 1C). However, mel1 in trans to a deficiency (either Df(1)BSC644 or Df(1)BSC872) showed a less severe hyperpigmentation near the interorbital bristles (Figure 1G). We did not score heads of the other non-complementing deficiencies, and it is not clear how these two deficiencies that overlap by ~87 kb/9 protein coding genes might fail to complement mel in the thorax, but give a less severe head phenotype. To further refine this mapping, we found that, when crossed with mel1, Dp(1;3)DC374 and Dp(1;3)DC554 rescue the wild-type pigmentation in both the thorax and head, while Dp(1;3)DC553; Dp(1;3)DC556; and Dp(1;3)DC409 do not. Taken together, these complementation results localized the mel locus to the ~72 kb region between positions 20,250,237–20,322,155, which contains five candidate protein coding genes: Inx6, Rab10, CG1504, CG42577, and CG17065 (Figure 1I). Mutations in four of these genes were individually tested by complementation with mel1. Only an allele of CG17065, CG17065CR, failed to complement mel¹ (Figure 1D, H). Further, flies homozygous for the CG17065CR mutation had the same dark body and trident phenotype as mel1. These data gave us a strong inclination that mel1 was a mutation in the CG17065 gene, and to test this, we amplified and sequenced CG17065 from wild-type OreR and mel1 flies. We found a single base change that causes a mis-sense mutation: histidine to leucine at amino acid 283 (Figure 1J). A second insertion in CG17065 (CG17065EY) was found to complement both mel1 and CG17065CR. The CG17065EY insertion is located in the 5’ UTR of all three splice isoforms; however, it does have a basal promoter and UAS sequences that would facilitate transcription of the CG17065 gene. Attempted mis/overexpression of CG17065 by crossing CG17065EY to different GAL4 drivers showed no pigmentation phenotypes or viability issues. Because CG17065CR has a melanized phenotype and fails to complement mel1, and mel1 has a missense mutation in CG17065, we conclude that CG17065 is the melanized gene. CG17065 encodes N-acetylglucosamine-6-phosphate deacetylase (abbreviated hereafter as GlcNAc-6-P deacetylase).
To understand how a single amino-acid substitution could generate such a pronounced loss of function, we examined the position of the H283L mutation within the GlcNAc-6-P deacetylase structure. We used the model for the human ortholog of GlcNAc-6-P deacetylase (called AMDHD2) because it had a structure available that included the bound ligand (https://doi.org/10.2210/pdb7NUT/pdb) (Kroef et al., 2022). From this, we found that Histidine 283 (Histidine 272 in human ortholog) lies in close proximity to the bound substrate, N-acetylglucosamine-6-phosphate (Figure 1K). In the wild-type protein, the imidazole side chain of Histidine 283 is positioned to form a stabilizing hydrogen bond with the O atom of the C1-hydroxyl group of the ligand, likely contributing to the proper orientation and affinity of substrate binding. Substituting histidine with leucine eliminates this polar, hydrogen-bonding-capable residue and introduces a hydrophobic side chain into an otherwise polar microenvironment. This change would then disrupt favorable electrostatic and hydrogen-bonding interactions and alter the geometry of the ligand-binding pocket, thereby reducing substrate affinity and reducing GlcNAc-6-P deacetylase activity.
To assess GlcNAc-6-P deacetylase expression across tissue types, we utilized the CG17065CR allele. This CRISPR insertion is a CRIMIC insertion that traps and truncates the mel/CG17065 transcript and initiates expression of GAL4 from mel/CG17065 mRNA (Kanca et al., 2022). Crossing this GAL4 line to a UAS-mCherry-NLS will reproduce the mel/CG17065 expression pattern. A colocalization approach involving Phalloidin and DAPI fluorescent staining was additionally used to visualize F-actin and nuclei staining, respectively. Here, we see near ubiquitous expression across Drosophila tissues. In third instar larvae, we see expression in imaginal discs (wing, eye-antennal, leg), brain, trachea, and body wall. Here we document notable expression in the salivary gland nuclei (arrowhead in Figure 1L) as well as associated fat body cells (arrow); the midgut (Figure 1M), and both cell types in Malpighian tubules: Stellate cells (arrow) and Principal cells (arrowhead in Figure 1N). We also examined ovarioles in adult females and see expression in ovarian follicle cells as seen in this stage 9 egg chamber (Figure 1O). We chose these tissues to show because they have large, clearly resolvable nuclei that can be recorded clearly by our lab’s microscopy equipment, not because of any potential relation to the phenotype. Because GlcNAc-6-P deacetylase is expressed in every tissue, it could be acting either autonomously or non-autonomously to produce the melanized phenotype.
How might a loss of function in GlcNAc-6-P deacetylase cause the pigmentation phenotype found in melanized? It is known that GlcNAc-6-P deacetylase, an enzyme involved in the hexosamine biosynthesis pathway, is responsible for the deacetylation of N-acetylglucosamine-6-phosphate (GlcNAc‑6‑P) to glucosamine-6-phosphate (Glc-6-P) (Paneque et al., 2023). GlcNAc-6-P is two enzymatic steps from UDP-GlcNAc, which is the starting material for both O- and N-linked glycosylation, as well as chitin formation. It is possible that the loss of GlcNAc-6-P deacetylase might cause an excess of GlcNAc-6-P, and thus an excess UDP-GlcNAc. Because UDP-GlcNAc is such a keystone molecule in multiple pathways, there is no shortage of potential mechanisms: Tyrosine Hydroxylase is regulated by O-linked glycosylation (da Costa Rodrigues et al., 2025); in Drosophila, loss of the hippo signaling pathway causes excess cuticle pigmentation (Gibson et al., 2025), and the kinase in the middle of the pathway (warts) has a human ortholog, LATS1 (Large Tumor Suppressor Kinase 1) that is regulated by O-linked glycosylation (Meng et al., 2026); and a different enzyme in the hexosamine biosynthesis pathway is required for mouse and human hair pigmentation (Tiede et al., 2021). Future experiments with melanized in cuticle pigmentation (such as mosaics to determine autonomy), the protein glycosylation pathways (such as looking for genetic interactions with mutations in the N- or O-linked pathways), and the chitin biosynthesis pathways (testing chitin composition, for example) should provide answers for how loss of the GlcNAc-6-P deacetylase can cause the melanized phenotype.
","references":[{"reference":"Chovnick A, Finnerty V, Schalet A, Duck P. 1969. STUDIES ON GENETIC ORGANIZATION IN HIGHER ORGANISMS: I. ANALYSIS OF A COMPLEX GENE IN DROSOPHILA MELANOGASTER. Genetics 62: 145-160.
","pubmedId":"","doi":"10.1093/genetics/62.1.145"},{"reference":"da Costa Rodrigues B, dos Santos Lucena MC, Costa ACR, de Araújo Oliveira I, Thaumaturgo M, Paes-Colli Y, et al., Dias. 2025. O-GlcNAcylation regulates tyrosine hydroxylase serine 40 phosphorylation and
Deal SL, Bei D, Gibson SB, Delgado-Seo H, Fujita Y, Wilwayco K, et al., Yamamoto. 2026. RNAi-based screen for pigmentation in Drosophila melanogaster reveals regulators of brain dopamine and sleep. iScience 29: 114388.
","pubmedId":"","doi":"10.1016/j.isci.2025.114388"},{"reference":"Dean DM, Deitcher DL, Paster CO, Xu M, Loehlin DW. 2022. “A fly appeared”: sable, a classic Drosophila mutation, maps to Yippee, a gene affecting body color, wings, and bristles. G3 Genes|Genomes|Genetics 12: 10.1093/g3journal/jkac058.
","pubmedId":"","doi":"10.1093/g3journal/jkac058"},{"reference":"Fahmy, O.G., Fahmy, M. 1958. New mutants report. Drosophila Information Service 32: 67–78.
","pubmedId":"","doi":""},{"reference":"Gibson SB, Deal SL, Park YJ, Sun B, Qi Y, Mok JW, et al., Yamamoto. 2025. Hippo signaling regulates cuticle pigmentation and dopamine metabolism in\n Drosophila. : 10.1101/2025.11.13.688152.
","pubmedId":"","doi":"10.1101/2025.11.13.688152"},{"reference":"Gloor, G., Engels, W. 1992. Single-fly DNA preps for PCR. Drosophila Information Service 71: 148–149.
","pubmedId":"","doi":""},{"reference":"HAN Q, FANG J, DING H, JOHNSON JK, CHRISTENSEN BM, LI J. 2002. Identification of Drosophila melanogaster yellow-f and yellow-f2 proteins as dopachrome-conversion enzymes. Biochemical Journal 368: 333-340.
","pubmedId":"","doi":"10.1042/BJ20020272"},{"reference":"Kanca O, Zirin J, Hu Y, Tepe B, Dutta D, Lin WW, et al., Bellen. 2022. An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination. eLife 11: 10.7554/elife.76077.
","pubmedId":"","doi":"10.7554/eLife.76077"},{"reference":"Kroef V, Ruegenberg S, Horn M, Allmeroth K, Ebert L, Bozkus S, et al., Denzel. 2022. GFPT2/GFAT2 and AMDHD2 act in tandem to control the hexosamine pathway. eLife 11: 10.7554/elife.69223.
","pubmedId":"","doi":"10.7554/eLife.69223"},{"reference":"Meng L, Wang Y, Zhou W, Wu S, Li J. 2026. O-GlcNAcylation of the tumor suppressor LATS1 drives mitotic progression via PLK1. Journal of Biological Chemistry 302: 110990.
","pubmedId":"","doi":"10.1016/j.jbc.2025.110990"},{"reference":"Miklos, G. L. G., Kramers, P. G. N., & Schalet, A. P. 1986. The proximal-distal orientation of two lethal complementation groups A112 and LB20 in region 19F at the base of the X chromosome. Drosophila Information Service 63: 96–97.
","pubmedId":"","doi":""},{"reference":"Paneque A, Fortus H, Zheng J, Werlen G, Jacinto E. 2023. The Hexosamine Biosynthesis Pathway: Regulation and Function. Genes 14: 933.
","pubmedId":"","doi":"10.3390/genes14040933"},{"reference":"Richardt A, Kemme T, Wagner S, Schwarzer D, Marahiel MA, Hovemann BT. 2003. Ebony, a Novel Nonribosomal Peptide Synthetase for β-Alanine Conjugation with Biogenic Amines in Drosophila. Journal of Biological Chemistry 278: 41160-41166.
","pubmedId":"","doi":"10.1074/jbc.M304303200"},{"reference":"Riedel F, Vorkel D, Eaton S. 2011. Megalin-dependent Yellow endocytosis restricts melanization in theDrosophilacuticle. Development 138: 149-158.
","pubmedId":"","doi":"10.1242/dev.056309"},{"reference":"Sickmann, M., Gohl, D. M., Affolter, M., & Muller, M. 2017. The Drosophila melanogaster straw locus is allelic to laccase2. Drosophila Information Service 100: 171–174.
","pubmedId":"","doi":""},{"reference":"Spana EP, Abrams AB, Ellis KT, Klein JC, Ruderman BT, Shi AH, et al., May. 2020. speck\n , First Identified in\n Drosophila melanogaster\n in 1910, Is Encoded by the Arylalkalamine N-Acetyltransferase (AANAT1) Gene. G3 Genes|Genomes|Genetics 10: 3387-3398.
","pubmedId":"","doi":"10.1534/g3.120.401470"},{"reference":"Tiede S, Hundt JE, Paus R. 2021. UDP-GlcNAc-1-Phosphotransferase Is a Clinically Important Regulator of Human and Mouse Hair Pigmentation. Journal of Investigative Dermatology 141: 2957-2965.e5.
","pubmedId":"","doi":"10.1016/j.jid.2021.04.028"},{"reference":"Wright TRF. 1987. The Genetics Of Biogenic Amine Metabolism, Sclerotization, And Melanization In Drosophila Melanogaster. Advances in Genetics,Molecular Genetics of Development : 127-222.
","pubmedId":"","doi":"//doi.org/10.1016/S0065-2660(08)60008-5"},{"reference":"Yamamoto S, Seto ES. 2014. Dopamine Dynamics and Signaling in <i>Drosophila</i>: An Overview of Genes, Drugs and Behavioral Paradigms. Experimental Animals 63: 107-119.
","pubmedId":"","doi":"10.1538/expanim.63.107"}],"title":"The melanized (mel) locus of Drosophila melanogaster is a mutation in CG17065, an N-acetylglucosamine-6-phosphate deacetylase
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"82e85bac-19c9-4125-88c5-cb5ff72badd3","decision":"accept","abstract":"Mutations in the melanized (mel) gene of Drosophila melanogaster display darker body pigmentation and an enhanced trident pattern on the notum. By complementation, we localized the gene underlying mel to CG17065, which encodes an N-acetylglucosamine-6-phosphate deacetylase. We find that mel1 is a missense mutation in a ligand-binding amino acid and that mel1 fails to complement a protein trap allele of CG17065. Using this allele, we find mel/CG17065 is ubiquitously expressed across larval and ovariole tissues. N-acetylglucosamine-6-phosphate deacetylase is predicted to act as an antagonist to the production of UDP-GlcNAc, the precursor for chitin biosynthesis and O- and N-linked glycosylation.
","acknowledgements":"We would like to thank the Bloomington Drosophila Stock Center for providing fly stocks and FlyBase.org for the detailed descriptions of the history of melanized and the hexosamine biosynthetic pathway. We would also like to thank the Spring 2017 Bio414LS class for preliminary mapping of melanized.
","authors":[{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["writing_originalDraft","investigation","formalAnalysis"],"email":"mayaaschandar01@gmail.com","firstName":"Maya ","lastName":"Chandar","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"emilymariaharc@gmail.com","firstName":"Emily","lastName":"Harclerode","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"elizabethgracekim@gmail.com","firstName":"Elizabeth","lastName":"Kim","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"jasmine.marsh@duke.edu","firstName":"Jasmine J. S. ","lastName":"Marsh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"a.dollymm@gmail.com","firstName":"Adolya ","lastName":"Moore","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0005-2339-1395"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"william.moragne@duke.edu","firstName":"William E. ","lastName":"Moragne III","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"danira.mukhamedyarova@duke.edu","firstName":"Danira R. ","lastName":"Mukhamedyarova","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0007-5425-5462 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ishaan.narsinghani@duke.edu","firstName":"Ishaan ","lastName":"Narsinghani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-1394-0304"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"cody.powell@icloud.com","firstName":"Cody J. ","lastName":"Powell","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ryann.pryor@duke.edu","firstName":"RyAnn ","lastName":"Pryor","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"radicalsubramani@gmail.com","firstName":"Radhika ","lastName":"Subramani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0003-2967-8640"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"blazekgregory@gmail.com","firstName":"Gregory M. ","lastName":"Blazek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-0763-2831"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"kaela.chan3@gmail.com","firstName":"Mikaela Inessa ","lastName":"Chandra","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-9624-8515"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"arjunramesh231@gmail.com","firstName":"Arjun ","lastName":"Ramesh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"stephanie.fogerson@gmail.com","firstName":"Stephanie M. ","lastName":"Fogerson","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"tania.guerrero@duke.edu","firstName":"Tania ","lastName":"Guerrero-Altamirano","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3808-9103 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","methodology","project","supervision","visualization","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"spana@duke.edu","firstName":"Eric P","lastName":"Spana","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2057-8278"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"We would like to thank Duke University Trinity College of Arts and Sciences and the Department of Biology for funding the Biology 414LS course in which this work was performed.
","image":{"url":"https://portal.micropublication.org/uploads/6deec3771ea100e09567902e1c402eb7.png"},"imageCaption":"(A) Wild type Oregon-R (OreR) D. melanogaster female shows normal body pigmentation. (B) A female of the genotype mel1 mal1 shows a slightly darker body and pronounced trident pattern due to mel1 and dull-colored eyes due to mal1. (C) A female of the genotype mel1 mal1/Df(1)BSC644 shows the same pigmentation as mel1 mal1 homozygotes. (D) A female of the genotype mel1 mal1/ CG17065CR has the same pigmentation phenotype as B and C. (E-H) Decapitated heads of the same genotypes as A-D shows the hypermelanized region in the ocellar region and near the interorbital bristles (especially F & H). (I) An approximately 75kb region of the X chromosome shows the overlap of the two duplications (light blue) that rescue mel1. Dp(1;3)DC374 extends off the map on the right, and Dp(1:3)DC554 extends off the map to the left. Five protein coding genes: Rab10, CG42577, Inx6, & CG1504 in dark blue and CG17065 in purple, and two non-coding RNA genes (CR45504, CR45505 in orange) lie within this region. Arrowheads indicate the four CR alleles used for complementation. (J) The melanized/CG17065 gene consists of three splice isoforms. The mel1 mutation is shown in red. The CG17065CR allele would terminate translation of the gene after exon 1. The CG17065EY insertion is found in the 5’UTR of all three isoforms. (K) A close-up view of the binding site of the human ortholog of mel/CG17065 (AMDHD2) bound to N-glucosamine-6-phosphate (green outline). The histidine sidechain (red outline) makes a hydrogen bond to the C-1 hydroxyl group of the glucosamine ring. This histidine is mutated to leucine in mel1. (L-M) Expression of mel/CG17065 as visualized by the GAL4 found in the CG17065CR insertion. Red is the expression of UAS-mCherry-NLS, blue is DAPI stained nuclei, and green is phalloidin. The merge of all three colors is shown in the fourth column. Scale bar is 100 μm. (L) mCherry-NLS is expressed in all the nuclei of the larval salivary gland (arrowhead) and associated fat body (arrow) at 200X. (M) mCherry-NLS is expressed in all nuclei of the larval midgut at 200X. (N) mCherry-NLS is expressed in both cell types of the larval Malpighian Tubule: the Stellate cells (arrow) and Principal cells (arrowhead) at 400X. (O) mCherry-NLS is expressed in all follicle cells in this Stage 9 egg chamber at 200X.
","imageTitle":"D. melanogaster melanized (mel) maps to CG17065 and is ubiquitously expressed
","methods":"Fly Imaging: To image adult flies, 5-10 day old females were anesthetized using FlyNap (Carolina Biological Supply Company) by placing a saturated FlyNap swab in the food vial for 2-5 minutes which allowed immobilization and was verified by tapping. Excess product was removed to ensure survival. Once anesthetized, flies were transferred to a white surface for optimal visibility and oriented with their dorsal side up. A Leica MZ12.5 stereomicroscope equipped with a Nikon D300S camera was adjusted to 50x magnification, and the camera was focused on the notum while keeping wings and legs in view. A hollow printer-paper cylinder (~2.5 cm diameter, ~2.5 cm high) was placed around the specimen to reduce ring-light reflection on the thorax while maintaining clear visualization of the fly in its natural position. This protocol is based on some of the methods seen here: http://gompel.org/wp-content/uploads/2015/09/Depth_of_field_Drosophila-photography.pdf
To image heads, females were anesthetized with CO₂. The heads were removed from the bodies using a razor blade and positioned on the end of a wooden toothpick (GoodCook Everyday Shake-A-Pick toothpick) and adhered with L.A. Colors clear topcoat nail polish. Once secure, the toothpick was positioned on a ~1 cm3 piece of modeling clay so that the dorsal side of the head was up. The total magnification was set to 63x and focused on the orbital bristle region to visualize the hyperpigmented patches. The heads were photographed above a BEHR paint swatch (Bluebird PPU15-12M, Home Depot) for optimal visibility.
Genomic DNA isolation from Drosophila: Genomic DNA was isolated from OreR, mel1mal1, and w1118 CG17065CR flies using Qiagen’s DNeasy Blood and Tissue kit (Cat no. / ID. 69504) and stored at -20ºC after isolation. For amplifying the CG17065EY region we used a squishing buffer prep (Gloor, 1992).
PCR & Sequencing: We used the genome sequence (r6.65) available on FlyBase and Primer3Plus (primer3plus.com) to design primers. The CG17065.CP-F and CG17065.CP-R primers were used to amplify the entire CG17065 locus using these conditions: 93° for 3 minutes to activate the polymerase, (93° for 30 seconds, 55° for 15 seconds, 72° for 2.5 minutes) x 35 cycles and a final 10-minute extension at 72°. For the CG17065CR insertion, we increased the extension time to 5 minutes. To verify the EY insertion, we used combinations of the primers: CG17065.EY-F and CG17065.EY-R (genomic primers) and the P-end primer (which is to the P-element inverted terminal repeat and will extend off both ends) under these conditions: 93° for 3 minutes to activate the polymerase, (93° for 30 seconds, 55° for 15 seconds, 72° for 0.5 minutes) x 35 cycles and a final 10-minute extension at 72°. We performed PCR using the UltraRun LongRange PCR Kit (QIAGEN). PCR products were sequenced using Oxford Nanopore technology by Plasmidsaurus.
Larvae/Ovariole staining: Wandering third instar larvae were dissected under PBS by tearing at the halfway point, and then inverting both the anterior and posterior ends. Mature female ovarioles were dissected by placing the female under PBS and removing the posterior end with ovarioles still attached. Dissected tissue was fixed for 30 minutes in PBS+4% paraformaldehyde. After fixation, the tissue was briefly rinsed 3 times with PBS+0.1% Triton X-100 (PBS+T), and then washed for 30 minutes in the same. Tissue was then stained by incubation with 1 µg/ml DAPI and 1:500 Alexa Fluor 488-Phalloidin for 30 minutes. After 3 brief washes in PBS+T, tissue was mounted in Vectashield+DAPI.
","reagents":"Reagent Type | Designation | Identifier | Reference/Source | Additional Information |
Genetic reagent (D. melanogaster) | OreR | N/A | Lab strain | Genotype: OreR |
Genetic reagent (D. melanogaster) | mel1mal1 | Derived from BDSC 3973 | Bloomington Drosophila Stock Center | Genotype: mel1mal1 Derived from y1 v1 mel1mal1 by recombination with OreR |
Genetic reagent (D. melanogaster) | CG17065CR | Derived from BDSC 93959 | Bloomington Drosophila Stock Center | Genotype: w1118 CG17065CR60133-TG4.1 Derived from y* w* CG17065CR60133-TG4.1 by recombination with w1118 |
Genetic reagent (D. melanogaster) | Rab10CR | BDSC 605429 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.1}Rab10CR71289-TG4.1 |
Genetic reagent (D. melanogaster) | Inx6CR | BDSC 600096 | Bloomington Drosophila Stock Center | y1 w* TI{KozakGAL4}Inx6CR70789-KO-kG4 |
Genetic reagent (D. melanogaster) | CG1504CR | BDSC 93929 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.0}CG1504CR02588-TG4.0 |
Genetic reagent (D. melanogaster) | CG17065EY | BDSC 16381 | Bloomington Drosophila Stock Center | y1 w67c23 P{EPgy2}CG17065EY06065 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC374 | BDSC 32282 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC374 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC554 | BDSC 33505 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC554/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC556 | BDSC 33506 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC556/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1:3)DC371 | BDSC 32281 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC371 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC553 | BDSC 33504 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC553/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC409 | BDSC 30799 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC409 |
Genetic reagent (D. melanogaster) | Df(1)HM44 | BDSC 6279 | Bloomington Drosophila Stock Center | Genotype: Df(1)HM44, y1 wa/ Dp(1;Y)y+ mal+ |
Genetic reagent (D. melanogaster) | Df(1)BSC644 | BDSC 25734 | Bloomington Drosophila Stock Center | Genotype: Df(1)BSC644 w1118 / Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC872 | BDSC 29995 | Bloomington Drosophila Stock Center | Df(1)BSC872, w1118 BSC872/FM7h/Dp(2;Y)G, P{hs-hid}Y |
Genetic reagent (D. melanogaster) | Df(1)BSC586 | BDSC 25420 | Bloomington Drosophila Stock Center | Df(1)BSC586, w1118/Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC648 | BDSC 25738 | Bloomington Drosophila Stock Center | Df(1)BSC648, w1118/FM7h/Dp(2;Y)G, P{w+mC=hs-hid}Y |
Genetic reagent (D. melanogaster) | UAS-mCherry.nls | BDSC 38424 | Bloomington Drosophila Stock Center | w*; P{w+, UAS-mCherry.NLS}3 |
Chemical | FlyNap | Carolina Biological Supply Company | ||
Chemical | Vectashield + DAPI | H-1200 | Vector Laboratories, Burlingame | |
Chemical | Alexa Fluor 488-Phalloidin | A12379 | Invitrogen | |
Software | Protein Data Bank | N/A | https://www.rcsb.org/ | |
PCR Kit | UltraRun LongRange PCR Kit | Cat no. / ID. 206442 | QIAGEN | |
Oligonucleotide | CG17065.CP-F primer | TAGCATTCGCATTTGCATTCG | Eton Bio | |
Oligonucleotide | CG17065.CP-R primer | GCACTGGAATTGGTTTCTCAGT | Eton Bio | |
Oligonucleotide | CG17065.EY-R primer | GTCGGGGGTGGCGCAAGG | Eton Bio | |
Oligonucleotide | CG17065.EY-F primer | TCTGGCTCCTCGCTGTTG | Eton Bio | |
Oligonucleotide | P-end primer | CGACGGGACCACCTTATGTTATTTCATCATG | Eton Bio |
The body pigmentation of the adult Drosophila melanogaster is produced through a combination of melanin and two sclerotization pathways, all of which are derived from dopamine (Wright, 1987). Dopamine is synthesized from tyrosine via Tyrosine Hydroxylase (encoded by the pale gene) and Dopa Decarboxylase (encoded by the Ddc gene) (reviewed in Yamamoto & Seto, 2014). That dopamine pool can be used by several pathways: it can be converted to melanin via the genes yellow, yellow-f, straw, and others (Han et al., 2002; Riedel et al., 2011; Sickmann et al., 2017); it can be converted to N-acetyldopamine (via the speck gene) for incorporation into NADA sclerotin (Spana et al., 2020), or it can be combined with beta-alanine (by the ebony gene) to make NBAD sclerotin (Richardt et al., 2003). A recent RNAi screen identified over 100 genes autonomously required for adult pigmentation (Deal et al., 2026). However, because of its rich research history, there are still viable strains of D. melanogaster available with body color defects that are unannotated or recently de-orphaned (Dean et al., 2022). Here we map the melanized (mel) gene via genetic complementation, and document its phenotype and expression.
Alleles of the mel gene have been isolated twice (mel1 and mel2) (Fahmy, O.G., Fahmy, M., 1958), however mel2 has been lost. mel1 has been described as having a darker body color and an especially prominent ‘trident’ on the thorax as well as dull red eyes and occasional upturned wings. It has been mapped genetically to 1-64.1(Fahmy, O.G., Fahmy, M., 1958) and cytologically to 19B-C (Chovnick et al., 1969). Of the three phenotypes associated with mel, we could only use complementation tests by scoring the body color. The wing phenotype was not penetrant enough and we could not distinguish the eye color phenotype (and the mel1 chromosome also carries an eye color mutation, maroon-like, mal1).
We first confirmed the phenotype of the mel1 allele. As expected, when compared to wild type Oregon-R (OreR) (Figure 1A) mel1 had a dark trident and darker body color (Figure 1B). Additionally, the melanized phenotype was prominently displayed in the ocular ridge around the eyes (Figure 1E, F). Next, to map mel1, we performed a series of complementation tests using deficiency and duplication stocks (abbreviated Df and Dp, respectively) to localize the mutation. We found that mel failed to complement Df(1)HM44 exactly as described in 1986 (Miklos et al., 1986) and crosses with wild type Oregon-R showed no dominant effect of mel, no thoracic tridents or darker bodies. We then tested five molecularly defined deficiency strains: Df(1)ED7635, Df(1)BSC644, Df(1)BSC872, Df(1)BSC648, and Df(1)BSC586 that span from 19A1 to 19E7. Of these, only Df(1)ED7635 complemented mel. That places mel between the left breakpoint of Df(1)BSC644 and the right breakpoint of Df(1)BSC872: the 19C1-4 range. When in trans to mel1, Df(1)BSC644 fails to complement and shows the same thoracic mel phenotype as mel1 homozygotes, indicating that mel1 is likely a strong, if not null, allele (Figure 1C). However, mel1 in trans to a deficiency (either Df(1)BSC644 or Df(1)BSC872) showed a less severe hyperpigmentation near the interorbital bristles (Figure 1G). We did not score heads of the other non-complementing deficiencies, and it is not clear how these two deficiencies that overlap by ~87 kb/9 protein coding genes might fail to complement mel in the thorax, but give a less severe head phenotype. To further refine this mapping, we found that, when crossed with mel1, Dp(1;3)DC374 and Dp(1;3)DC554 rescue the wild-type pigmentation in both the thorax and head, while Dp(1;3)DC553; Dp(1;3)DC556; and Dp(1;3)DC409 do not. Taken together, these complementation results localized the mel locus to the ~72 kb region between positions 20,250,237–20,322,155, which contains five candidate protein coding genes: Inx6, Rab10, CG1504, CG42577, and CG17065 (Figure 1I). Mutations in four of these genes were individually tested by complementation with mel1. Only an allele of CG17065, CG17065CR, failed to complement mel¹ (Figure 1D, H). Further, flies homozygous for the CG17065CR mutation had the same dark body and trident phenotype as mel1. These data gave us a strong inclination that mel1 was a mutation in the CG17065 gene, and to test this, we amplified and sequenced CG17065 from wild-type OreR and mel1 flies. We found a single base change that causes a mis-sense mutation: histidine to leucine at amino acid 283 (Figure 1J). A second insertion in CG17065 (CG17065EY) was found to complement both mel1 and CG17065CR. The CG17065EY insertion is located in the 5’ UTR of all three splice isoforms; however, it does have a basal promoter and UAS sequences that would facilitate transcription of the CG17065 gene. Attempted mis/overexpression of CG17065 by crossing CG17065EY to different GAL4 drivers showed no pigmentation phenotypes or viability issues. Because CG17065CR has a melanized phenotype and fails to complement mel1, and mel1 has a missense mutation in CG17065, we conclude that CG17065 is the melanized gene. CG17065 encodes N-acetylglucosamine-6-phosphate deacetylase (abbreviated hereafter as GlcNAc-6-P deacetylase).
To understand how a single amino-acid substitution could generate such a pronounced loss of function, we examined the position of the H283L mutation within the GlcNAc-6-P deacetylase structure. We used the model for the human ortholog of GlcNAc-6-P deacetylase (called AMDHD2) because it had a structure available that included the bound ligand (https://doi.org/10.2210/pdb7NUT/pdb) (Kroef et al., 2022). From this, we found that Histidine 283 (Histidine 272 in human ortholog) lies in close proximity to the bound substrate, N-acetylglucosamine-6-phosphate (Figure 1K). In the wild-type protein, the imidazole side chain of Histidine 283 is positioned to form a stabilizing hydrogen bond with the O atom of the C1-hydroxyl group of the ligand, likely contributing to the proper orientation and affinity of substrate binding. Substituting histidine with leucine eliminates this polar, hydrogen-bonding-capable residue and introduces a hydrophobic side chain into an otherwise polar microenvironment. This change would then disrupt favorable electrostatic and hydrogen-bonding interactions and alter the geometry of the ligand-binding pocket, thereby reducing substrate affinity and reducing GlcNAc-6-P deacetylase activity.
To assess GlcNAc-6-P deacetylase expression across tissue types, we utilized the CG17065CR allele. This CRISPR insertion is a CRIMIC insertion that traps and truncates the mel/CG17065 transcript and initiates expression of GAL4 from mel/CG17065 mRNA (Kanca et al., 2022). Crossing this GAL4 line to a UAS-mCherry-NLS will reproduce the mel/CG17065 expression pattern. A colocalization approach involving Phalloidin and DAPI fluorescent staining was additionally used to visualize F-actin and nuclei staining, respectively. Here, we see near ubiquitous expression across Drosophila tissues. In third instar larvae, we see expression in imaginal discs (wing, eye-antennal, leg), brain, trachea, and body wall. Here we document notable expression in the salivary gland nuclei (arrowhead in Figure 1L) as well as associated fat body cells (arrow); the midgut (Figure 1M), and both cell types in Malpighian tubules: Stellate cells (arrow) and Principal cells (arrowhead in Figure 1N). We also examined ovarioles in adult females and see expression in ovarian follicle cells as seen in this stage 9 egg chamber (Figure 1O). We chose these tissues to show because they have large, clearly resolvable nuclei that can be recorded clearly by our lab’s microscopy equipment, not because of any potential relation to the phenotype. Because GlcNAc-6-P deacetylase is expressed in every tissue, it could be acting either autonomously or non-autonomously to produce the melanized phenotype.
How might a loss of function in GlcNAc-6-P deacetylase cause the pigmentation phenotype found in melanized? It is known that GlcNAc-6-P deacetylase, an enzyme involved in the hexosamine biosynthesis pathway, is responsible for the deacetylation of N-acetylglucosamine-6-phosphate (GlcNAc‑6‑P) to glucosamine-6-phosphate (Glc-6-P) (Paneque et al., 2023). GlcNAc-6-P is two enzymatic steps from UDP-GlcNAc, which is the starting material for both O- and N-linked glycosylation, as well as chitin formation. It is possible that the loss of GlcNAc-6-P deacetylase might cause an excess of GlcNAc-6-P, and thus an excess UDP-GlcNAc. Because UDP-GlcNAc is such a keystone molecule in multiple pathways, there is no shortage of potential mechanisms: Tyrosine Hydroxylase is regulated by O-linked glycosylation (da Costa Rodrigues et al., 2025); in Drosophila, loss of the hippo signaling pathway causes excess cuticle pigmentation (Gibson et al., 2025), and the kinase in the middle of the pathway (warts) has a human ortholog, LATS1 (Large Tumor Suppressor Kinase 1) that is regulated by O-linked glycosylation (Meng et al., 2026); and a different enzyme in the hexosamine biosynthesis pathway is required for mouse and human hair pigmentation (Tiede et al., 2021). Future experiments with melanized in cuticle pigmentation (such as mosaics to determine autonomy), the protein glycosylation pathways (such as looking for genetic interactions with mutations in the N- or O-linked pathways), and the chitin biosynthesis pathways (testing chitin composition, for example) should provide answers for how loss of the GlcNAc-6-P deacetylase can cause the melanized phenotype.
","references":[{"reference":"Chovnick A, Finnertty V, Schalet A, Duck P. 1969. Studies on genetic organization in higher organisms. I. Analysis of a complex gene in Drosophila melanogaster. Genetics 62(1): 145-60.
","pubmedId":"5371011","doi":""},{"reference":"da Costa Rodrigues B, Dos Santos Lucena MC, Costa ACR, de Araújo Oliveira I, Thaumaturgo M, Paes-Colli Y, et al., Dias WB. 2025. O-GlcNAcylation regulates tyrosine hydroxylase serine 40 phosphorylation and l-DOPA levels. Am J Physiol Cell Physiol 328(3): C825-C835.
","pubmedId":"39870381","doi":""},{"reference":"Deal SL, Bei D, Gibson SB, Delgado-Seo H, Fujita Y, Wilwayco K, et al., Yamamoto S. 2026. RNAi-based screen for pigmentation in Drosophila melanogaster reveals regulators of brain dopamine and sleep. iScience 29(1): 114388.
","pubmedId":"41561374","doi":""},{"reference":"Dean DM, Deitcher DL, Paster CO, Xu M, Loehlin DW. 2022. \"A fly appeared\": sable, a classic Drosophila mutation, maps to Yippee, a gene affecting body color, wings, and bristles. G3 (Bethesda) 12(5): 10.1093/g3journal/jkac058.
","pubmedId":"35266526","doi":""},{"reference":"Fahmy, O.G., Fahmy, M. 1958. New mutants report. Drosophila Information Service 32: 67–78.
","pubmedId":"","doi":""},{"reference":"Gibson SB, Deal SL, Park YJ, Sun B, Qi Y, Mok JW, et al., Yamamoto S. 2025. Hippo signaling regulates cuticle pigmentation and dopamine metabolism in Drosophila. bioRxiv: pii: 2025.11.13.688152. 10.1101/2025.11.13.688152.
","pubmedId":"41292750","doi":""},{"reference":"Gloor, G., Engels, W. 1992. Single-fly DNA preps for PCR. Drosophila Information Service 71: 148–149.
","pubmedId":"","doi":""},{"reference":"Han Q, Fang J, Ding H, Johnson JK, Christensen BM, Li J. 2002. Identification of Drosophila melanogaster yellow-f and yellow-f2 proteins as dopachrome-conversion enzymes. Biochem J 368(Pt 1): 333-40.
","pubmedId":"12164780","doi":""},{"reference":"Kanca O, Zirin J, Hu Y, Tepe B, Dutta D, Lin WW, et al., Bellen HJ. 2022. An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination. Elife 11: 10.7554/eLife.76077.
","pubmedId":"35723254","doi":""},{"reference":"Kroef V, Ruegenberg S, Horn M, Allmeroth K, Ebert L, Bozkus S, et al., Denzel MS. 2022. GFPT2/GFAT2 and AMDHD2 act in tandem to control the hexosamine pathway. Elife 11: 10.7554/eLife.69223.
","pubmedId":"35229715","doi":""},{"reference":"Meng L, Wang Y, Zhou W, Wu S, Li J. 2026. O-GlcNAcylation of the tumor suppressor LATS1 drives mitotic progression via PLK1. J Biol Chem 302(1): 110990.
","pubmedId":"41338457","doi":""},{"reference":"Miklos, G. L. G., Kramers, P. G. N., & Schalet, A. P. 1986. The proximal-distal orientation of two lethal complementation groups A112 and LB20 in region 19F at the base of the X chromosome. Drosophila Information Service 63: 96–97.
","pubmedId":"","doi":""},{"reference":"Paneque A, Fortus H, Zheng J, Werlen G, Jacinto E. 2023. The Hexosamine Biosynthesis Pathway: Regulation and Function. Genes (Basel) 14(4): 10.3390/genes14040933.
","pubmedId":"37107691","doi":""},{"reference":"Richardt A, Kemme T, Wagner S, Schwarzer D, Marahiel MA, Hovemann BT. 2003. Ebony, a novel nonribosomal peptide synthetase for beta-alanine conjugation with biogenic amines in Drosophila. J Biol Chem 278(42): 41160-6.
","pubmedId":"12900414","doi":""},{"reference":"Riedel F, Vorkel D, Eaton S. 2011. Megalin-dependent yellow endocytosis restricts melanization in the Drosophila cuticle. Development 138(1): 149-58.
","pubmedId":"21138977","doi":""},{"reference":"Sickmann, M., Gohl, D. M., Affolter, M., & Muller, M. 2017. The Drosophila melanogaster straw locus is allelic to laccase2. Drosophila Information Service 100: 171–174.
","pubmedId":"","doi":""},{"reference":"Spana EP, Abrams AB, Ellis KT, Klein JC, Ruderman BT, Shi AH, et al., May S. 2020. speck, First Identified in Drosophila melanogaster in 1910, Is Encoded by the Arylalkalamine N-Acetyltransferase (AANAT1) Gene. G3 (Bethesda) 10(9): 3387-3398.
","pubmedId":"32709620","doi":""},{"reference":"Tiede S, Hundt JE, Paus R. 2021. UDP-GlcNAc-1-Phosphotransferase Is a Clinically Important Regulator of Human and Mouse Hair Pigmentation. J Invest Dermatol 141(12): 2957-2965.e5.
","pubmedId":"34116066","doi":""},{"reference":"Wright TR. 1987. The genetics of biogenic amine metabolism, sclerotization, and melanization in Drosophila melanogaster. Adv Genet 24: 127-222.
","pubmedId":"3124532","doi":""},{"reference":"Yamamoto S, Seto ES. 2014. Dopamine dynamics and signaling in Drosophila: an overview of genes, drugs and behavioral paradigms. Exp Anim 63(2): 107-19.
","pubmedId":"24770636","doi":""}],"title":"The melanized (mel) locus of Drosophila melanogaster is a mutation in CG17065, an N-acetylglucosamine-6-phosphate deacetylase
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"b0219acf-4cb2-4514-9a77-fea1fdcb909a","decision":"publish","abstract":"Mutations in the melanized (mel) gene of Drosophila melanogaster display darker body pigmentation and an enhanced trident pattern on the notum. By complementation, we localized the gene underlying mel to CG17065, which encodes an N-acetylglucosamine-6-phosphate deacetylase. We find that mel1 is a missense mutation in a ligand-binding amino acid and that mel1 fails to complement a protein trap allele of CG17065. Using this allele, we find mel/CG17065 is ubiquitously expressed across larval and ovariole tissues. N-acetylglucosamine-6-phosphate deacetylase is predicted to act as an antagonist to the production of UDP-GlcNAc, the precursor for chitin biosynthesis and O- and N-linked glycosylation.
","acknowledgements":"We would like to thank the Bloomington Drosophila Stock Center for providing fly stocks and FlyBase.org for the detailed descriptions of the history of melanized and the hexosamine biosynthetic pathway. We would also like to thank the Spring 2017 Bio414LS class for preliminary mapping of melanized.
","authors":[{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["writing_originalDraft","investigation","formalAnalysis"],"email":"mayaaschandar01@gmail.com","firstName":"Maya ","lastName":"Chandar","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"emilymariaharc@gmail.com","firstName":"Emily","lastName":"Harclerode","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"elizabethgracekim@gmail.com","firstName":"Elizabeth","lastName":"Kim","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"jasmine.marsh@duke.edu","firstName":"Jasmine J. S. ","lastName":"Marsh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"a.dollymm@gmail.com","firstName":"Adolya ","lastName":"Moore","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0005-2339-1395"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"william.moragne@duke.edu","firstName":"William E. ","lastName":"Moragne III","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"danira.mukhamedyarova@duke.edu","firstName":"Danira R. ","lastName":"Mukhamedyarova","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0007-5425-5462 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ishaan.narsinghani@duke.edu","firstName":"Ishaan ","lastName":"Narsinghani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-1394-0304"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"cody.powell@icloud.com","firstName":"Cody J. ","lastName":"Powell","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"ryann.pryor@duke.edu","firstName":"RyAnn ","lastName":"Pryor","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"radicalsubramani@gmail.com","firstName":"Radhika ","lastName":"Subramani","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0003-2967-8640"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"blazekgregory@gmail.com","firstName":"Gregory M. ","lastName":"Blazek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-0763-2831"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"kaela.chan3@gmail.com","firstName":"Mikaela Inessa ","lastName":"Chandra","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-9624-8515"},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft"],"email":"arjunramesh231@gmail.com","firstName":"Arjun ","lastName":"Ramesh","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"stephanie.fogerson@gmail.com","firstName":"Stephanie M. ","lastName":"Fogerson","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","supervision"],"email":"tania.guerrero@duke.edu","firstName":"Tania ","lastName":"Guerrero-Altamirano","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3808-9103 "},{"affiliations":["Duke University, Durham, NC, US"],"departments":["Department of Biology"],"credit":["formalAnalysis","investigation","methodology","project","supervision","visualization","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"spana@duke.edu","firstName":"Eric P","lastName":"Spana","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2057-8278"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"We would like to thank Duke University Trinity College of Arts and Sciences and the Department of Biology for funding the Biology 414LS course in which this work was performed.
","image":{"url":"https://portal.micropublication.org/uploads/6deec3771ea100e09567902e1c402eb7.png"},"imageCaption":"(A) Wild type Oregon-R (OreR) D. melanogaster female shows normal body pigmentation. (B) A female of the genotype mel1 mal1 shows a slightly darker body and pronounced trident pattern due to mel1 and dull-colored eyes due to mal1. (C) A female of the genotype mel1 mal1/Df(1)BSC644 shows the same pigmentation as mel1 mal1 homozygotes. (D) A female of the genotype mel1 mal1/ CG17065CR has the same pigmentation phenotype as B and C. (E-H) Decapitated heads of the same genotypes as A-D shows the hypermelanized region in the ocellar region and near the interorbital bristles (especially F & H). (I) An approximately 75kb region of the X chromosome shows the overlap of the two duplications (light blue) that rescue mel1. Dp(1;3)DC374 extends off the map on the right, and Dp(1:3)DC554 extends off the map to the left. Five protein coding genes: Rab10, CG42577, Inx6, & CG1504 in dark blue and CG17065 in purple, and two non-coding RNA genes (CR45504, CR45505 in orange) lie within this region. Arrowheads indicate the four CR alleles used for complementation. (J) The melanized/CG17065 gene consists of three splice isoforms. The mel1 mutation is shown in red. The CG17065CR allele would terminate translation of the gene after exon 1. The CG17065EY insertion is found in the 5’UTR of all three isoforms. (K) A close-up view of the binding site of the human ortholog of mel/CG17065 (AMDHD2) bound to N-glucosamine-6-phosphate (green outline). The histidine sidechain (red outline) makes a hydrogen bond to the C-1 hydroxyl group of the glucosamine ring. This histidine is mutated to leucine in mel1. (L-M) Expression of mel/CG17065 as visualized by the GAL4 found in the CG17065CR insertion. Red is the expression of UAS-mCherry-NLS, blue is DAPI stained nuclei, and green is phalloidin. The merge of all three colors is shown in the fourth column. Scale bar is 100 μm. (L) mCherry-NLS is expressed in all the nuclei of the larval salivary gland (arrowhead) and associated fat body (arrow) at 200X. (M) mCherry-NLS is expressed in all nuclei of the larval midgut at 200X. (N) mCherry-NLS is expressed in both cell types of the larval Malpighian Tubule: the Stellate cells (arrow) and Principal cells (arrowhead) at 400X. (O) mCherry-NLS is expressed in all follicle cells in this Stage 9 egg chamber at 200X.
","imageTitle":"D. melanogaster melanized (mel) maps to CG17065 and is ubiquitously expressed
","methods":"Fly Imaging: To image adult flies, 5-10 day old females were anesthetized using FlyNap (Carolina Biological Supply Company) by placing a saturated FlyNap swab in the food vial for 2-5 minutes which allowed immobilization and was verified by tapping. Excess product was removed to ensure survival. Once anesthetized, flies were transferred to a white surface for optimal visibility and oriented with their dorsal side up. A Leica MZ12.5 stereomicroscope equipped with a Nikon D300S camera was adjusted to 50x magnification, and the camera was focused on the notum while keeping wings and legs in view. A hollow printer-paper cylinder (~2.5 cm diameter, ~2.5 cm high) was placed around the specimen to reduce ring-light reflection on the thorax while maintaining clear visualization of the fly in its natural position. This protocol is based on some of the methods seen here: http://gompel.org/wp-content/uploads/2015/09/Depth_of_field_Drosophila-photography.pdf
To image heads, females were anesthetized with CO₂. The heads were removed from the bodies using a razor blade and positioned on the end of a wooden toothpick (GoodCook Everyday Shake-A-Pick toothpick) and adhered with L.A. Colors clear topcoat nail polish. Once secure, the toothpick was positioned on a ~1 cm3 piece of modeling clay so that the dorsal side of the head was up. The total magnification was set to 63x and focused on the orbital bristle region to visualize the hyperpigmented patches. The heads were photographed above a BEHR paint swatch (Bluebird PPU15-12M, Home Depot) for optimal visibility.
Genomic DNA isolation from Drosophila: Genomic DNA was isolated from OreR, mel1mal1, and w1118 CG17065CR flies using Qiagen’s DNeasy Blood and Tissue kit (Cat no. / ID. 69504) and stored at -20ºC after isolation. For amplifying the CG17065EY region we used a squishing buffer prep (Gloor, 1992).
PCR & Sequencing: We used the genome sequence (r6.65) available on FlyBase and Primer3Plus (www.primer3plus.com) to design primers. The CG17065.CP-F and CG17065.CP-R primers were used to amplify the entire CG17065 locus using these conditions: 93° for 3 minutes to activate the polymerase, (93° for 30 seconds, 55° for 15 seconds, 72° for 2.5 minutes) x 35 cycles and a final 10-minute extension at 72°. For the CG17065CR insertion, we increased the extension time to 5 minutes. To verify the EY insertion, we used combinations of the primers: CG17065.EY-F and CG17065.EY-R (genomic primers) and the P-end primer (which is to the P-element inverted terminal repeat and will extend off both ends) under these conditions: 93° for 3 minutes to activate the polymerase, (93° for 30 seconds, 55° for 15 seconds, 72° for 0.5 minutes) x 35 cycles and a final 10-minute extension at 72°. We performed PCR using the UltraRun LongRange PCR Kit (QIAGEN). PCR products were sequenced using Oxford Nanopore technology by Plasmidsaurus.
Larvae/Ovariole staining: Wandering third instar larvae were dissected under PBS by tearing at the halfway point, and then inverting both the anterior and posterior ends. Mature female ovarioles were dissected by placing the female under PBS and removing the posterior end with ovarioles still attached. Dissected tissue was fixed for 30 minutes in PBS+4% paraformaldehyde. After fixation, the tissue was briefly rinsed 3 times with PBS+0.1% Triton X-100 (PBS+T), and then washed for 30 minutes in the same. Tissue was then stained by incubation with 1 µg/ml DAPI and 1:500 Alexa Fluor 488-Phalloidin for 30 minutes. After 3 brief washes in PBS+T, tissue was mounted in Vectashield+DAPI.
","reagents":"Reagent Type | Designation | Identifier | Reference/Source | Additional Information |
Genetic reagent (D. melanogaster) | OreR | N/A | Lab strain | Genotype: OreR |
Genetic reagent (D. melanogaster) | mel1mal1 | Derived from BDSC 3973 | Bloomington Drosophila Stock Center | Genotype: mel1mal1 Derived from y1 v1 mel1mal1 by recombination with OreR |
Genetic reagent (D. melanogaster) | CG17065CR | Derived from BDSC 93959 | Bloomington Drosophila Stock Center | Genotype: w1118 CG17065CR60133-TG4.1 Derived from y* w* CG17065CR60133-TG4.1 by recombination with w1118 |
Genetic reagent (D. melanogaster) | Rab10CR | BDSC 605429 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.1}Rab10CR71289-TG4.1 |
Genetic reagent (D. melanogaster) | Inx6CR | BDSC 600096 | Bloomington Drosophila Stock Center | y1 w* TI{KozakGAL4}Inx6CR70789-KO-kG4 |
Genetic reagent (D. melanogaster) | CG1504CR | BDSC 93929 | Bloomington Drosophila Stock Center | y1 w* TI{CRIMIC.TG4.0}CG1504CR02588-TG4.0 |
Genetic reagent (D. melanogaster) | CG17065EY | BDSC 16381 | Bloomington Drosophila Stock Center | y1 w67c23 P{EPgy2}CG17065EY06065 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC374 | BDSC 32282 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC374 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC554 | BDSC 33505 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC554/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC556 | BDSC 33506 | Bloomington Drosophila Stock Center | Genotype: w1118 ; Dp(1;3)DC556/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1:3)DC371 | BDSC 32281 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC371 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC553 | BDSC 33504 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC553/TM6C, Sb1 |
Genetic reagent (D. melanogaster) | Dp(1;3)DC409 | BDSC 30799 | Bloomington Drosophila Stock Center | w1118; Dp(1;3)DC409 |
Genetic reagent (D. melanogaster) | Df(1)HM44 | BDSC 6279 | Bloomington Drosophila Stock Center | Genotype: Df(1)HM44, y1 wa/ Dp(1;Y)y+ mal+ |
Genetic reagent (D. melanogaster) | Df(1)BSC644 | BDSC 25734 | Bloomington Drosophila Stock Center | Genotype: Df(1)BSC644 w1118 / Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC872 | BDSC 29995 | Bloomington Drosophila Stock Center | Df(1)BSC872, w1118 BSC872/FM7h/Dp(2;Y)G, P{hs-hid}Y |
Genetic reagent (D. melanogaster) | Df(1)BSC586 | BDSC 25420 | Bloomington Drosophila Stock Center | Df(1)BSC586, w1118/Binsinscy |
Genetic reagent (D. melanogaster) | Df(1)BSC648 | BDSC 25738 | Bloomington Drosophila Stock Center | Df(1)BSC648, w1118/FM7h/Dp(2;Y)G, P{w+mC=hs-hid}Y |
Genetic reagent (D. melanogaster) | UAS-mCherry.nls | BDSC 38424 | Bloomington Drosophila Stock Center | w*; P{w+, UAS-mCherry.NLS}3 |
Chemical | FlyNap | Carolina Biological Supply Company | ||
Chemical | Vectashield + DAPI | H-1200 | Vector Laboratories, Burlingame | |
Chemical | Alexa Fluor 488-Phalloidin | A12379 | Invitrogen | |
Software | Protein Data Bank | N/A | https://www.rcsb.org/ | |
PCR Kit | UltraRun LongRange PCR Kit | Cat no. / ID. 206442 | QIAGEN | |
Oligonucleotide | CG17065.CP-F primer | TAGCATTCGCATTTGCATTCG | Eton Bio | |
Oligonucleotide | CG17065.CP-R primer | GCACTGGAATTGGTTTCTCAGT | Eton Bio | |
Oligonucleotide | CG17065.EY-R primer | GTCGGGGGTGGCGCAAGG | Eton Bio | |
Oligonucleotide | CG17065.EY-F primer | TCTGGCTCCTCGCTGTTG | Eton Bio | |
Oligonucleotide | P-end primer | CGACGGGACCACCTTATGTTATTTCATCATG | Eton Bio |
The body pigmentation of the adult Drosophila melanogaster is produced through a combination of melanin and two sclerotization pathways, all of which are derived from dopamine (Wright, 1987). Dopamine is synthesized from tyrosine via Tyrosine Hydroxylase (encoded by the pale gene) and Dopa Decarboxylase (encoded by the Ddc gene) (reviewed in Yamamoto & Seto, 2014). That dopamine pool can be used by several pathways: it can be converted to melanin via the genes yellow, yellow-f, straw, and others (Han et al., 2002; Riedel et al., 2011; Sickmann et al., 2017); it can be converted to N-acetyldopamine (via the speck gene) for incorporation into NADA sclerotin (Spana et al., 2020), or it can be combined with beta-alanine (by the ebony gene) to make NBAD sclerotin (Richardt et al., 2003). A recent RNAi screen identified over 100 genes autonomously required for adult pigmentation (Deal et al., 2026). However, because of its rich research history, there are still viable strains of D. melanogaster available with body color defects that are unannotated or recently de-orphaned (Dean et al., 2022). Here we map the melanized (mel) gene via genetic complementation, and document its phenotype and expression.
Alleles of the mel gene have been isolated twice (mel1 and mel2) (Fahmy, O.G., Fahmy, M., 1958), however mel2 has been lost. mel1 has been described as having a darker body color and an especially prominent ‘trident’ on the thorax as well as dull red eyes and occasional upturned wings. It has been mapped genetically to 1-64.1 (Fahmy, O.G., Fahmy, M., 1958) and cytologically to 19B-C (Chovnick et al., 1969). Of the three phenotypes associated with mel, we could only use complementation tests by scoring the body color. The wing phenotype was not penetrant enough and we could not distinguish the eye color phenotype (and the mel1 chromosome also carries an eye color mutation, maroon-like, mal1).
We first confirmed the phenotype of the mel1 allele. As expected, when compared to wild type Oregon-R (OreR) (Figure 1A) mel1 had a dark trident and darker body color (Figure 1B). Additionally, the melanized phenotype was prominently displayed in the ocular ridge around the eyes (Figure 1E, F). Next, to map mel1, we performed a series of complementation tests using deficiency and duplication stocks (abbreviated Df and Dp, respectively) to localize the mutation. We found that mel failed to complement Df(1)HM44 exactly as described in 1986 (Miklos et al., 1986) and crosses with wild type Oregon-R showed no dominant effect of mel, no thoracic tridents or darker bodies. We then tested five molecularly defined deficiency strains: Df(1)ED7635, Df(1)BSC644, Df(1)BSC872, Df(1)BSC648, and Df(1)BSC586 that span from 19A1 to 19E7. Of these, only Df(1)ED7635 complemented mel. That places mel between the left breakpoint of Df(1)BSC644 and the right breakpoint of Df(1)BSC872: the 19C1-4 range. When in trans to mel1, Df(1)BSC644 fails to complement and shows the same thoracic mel phenotype as mel1 homozygotes, indicating that mel1 is likely a strong, if not null, allele (Figure 1C). However, mel1 in trans to a deficiency (either Df(1)BSC644 or Df(1)BSC872) showed a less severe hyperpigmentation near the interorbital bristles (Figure 1G). We did not score heads of the other non-complementing deficiencies, and it is not clear how these two deficiencies that overlap by ~87 kb/9 protein coding genes might fail to complement mel in the thorax, but give a less severe head phenotype. To further refine this mapping, we found that, when crossed with mel1, Dp(1;3)DC374 and Dp(1;3)DC554 rescue the wild-type pigmentation in both the thorax and head, while Dp(1;3)DC553; Dp(1;3)DC556; and Dp(1;3)DC409 do not. Taken together, these complementation results localized the mel locus to the ~72 kb region between positions 20,250,237–20,322,155, which contains five candidate protein coding genes: Inx6, Rab10, CG1504, CG42577, and CG17065 (Figure 1I). Mutations in four of these genes were individually tested by complementation with mel1. Only an allele of CG17065, CG17065CR, failed to complement mel¹ (Figure 1D, H). Further, flies homozygous for the CG17065CR mutation had the same dark body and trident phenotype as mel1. These data gave us a strong inclination that mel1 was a mutation in the CG17065 gene, and to test this, we amplified and sequenced CG17065 from wild-type OreR and mel1 flies. We found a single base change that causes a mis-sense mutation: histidine to leucine at amino acid 283 (Figure 1J). A second insertion in CG17065 (CG17065EY) was found to complement both mel1 and CG17065CR. The CG17065EY insertion is located in the 5’ UTR of all three splice isoforms; however, it does have a basal promoter and UAS sequences that would facilitate transcription of the CG17065 gene. Attempted mis/overexpression of CG17065 by crossing CG17065EY to different GAL4 drivers showed no pigmentation phenotypes or viability issues. Because CG17065CR has a melanized phenotype and fails to complement mel1, and mel1 has a missense mutation in CG17065, we conclude that CG17065 is the melanized gene. CG17065 encodes N-acetylglucosamine-6-phosphate deacetylase (abbreviated hereafter as GlcNAc-6-P deacetylase).
To understand how a single amino-acid substitution could generate such a pronounced loss of function, we examined the position of the H283L mutation within the GlcNAc-6-P deacetylase structure. We used the model for the human ortholog of GlcNAc-6-P deacetylase (called AMDHD2) because it had a structure available that included the bound ligand (https://doi.org/10.2210/pdb7NUT/pdb) (Kroef et al., 2022). From this, we found that Histidine 283 (Histidine 272 in human ortholog) lies in close proximity to the bound substrate, N-acetylglucosamine-6-phosphate (Figure 1K). In the wild-type protein, the imidazole side chain of Histidine 283 is positioned to form a stabilizing hydrogen bond with the O atom of the C1-hydroxyl group of the ligand, likely contributing to the proper orientation and affinity of substrate binding. Substituting histidine with leucine eliminates this polar, hydrogen-bonding-capable residue and introduces a hydrophobic side chain into an otherwise polar microenvironment. This change would then disrupt favorable electrostatic and hydrogen-bonding interactions and alter the geometry of the ligand-binding pocket, thereby reducing substrate affinity and reducing GlcNAc-6-P deacetylase activity.
To assess GlcNAc-6-P deacetylase expression across tissue types, we utilized the CG17065CR allele. This CRISPR insertion is a CRIMIC insertion that traps and truncates the mel/CG17065 transcript and initiates expression of GAL4 from mel/CG17065 mRNA (Kanca et al., 2022). Crossing this GAL4 line to a UAS-mCherry-NLS will reproduce the mel/CG17065 expression pattern. A colocalization approach involving Phalloidin and DAPI fluorescent staining was additionally used to visualize F-actin and nuclei staining, respectively. Here, we see near ubiquitous expression across Drosophila tissues. In third instar larvae, we see expression in imaginal discs (wing, eye-antennal, leg), brain, trachea, and body wall. Here we document notable expression in the salivary gland nuclei (arrowhead in Figure 1L) as well as associated fat body cells (arrow); the midgut (Figure 1M), and both cell types in Malpighian tubules: Stellate cells (arrow) and Principal cells (arrowhead in Figure 1N). We also examined ovarioles in adult females and see expression in ovarian follicle cells as seen in this stage 9 egg chamber (Figure 1O). We chose these tissues to show because they have large, clearly resolvable nuclei that can be recorded clearly by our lab’s microscopy equipment, not because of any potential relation to the phenotype. Because GlcNAc-6-P deacetylase is expressed in every tissue, it could be acting either autonomously or non-autonomously to produce the melanized phenotype.
How might a loss of function in GlcNAc-6-P deacetylase cause the pigmentation phenotype found in melanized? It is known that GlcNAc-6-P deacetylase, an enzyme involved in the hexosamine biosynthesis pathway, is responsible for the deacetylation of N-acetylglucosamine-6-phosphate (GlcNAc‑6‑P) to glucosamine-6-phosphate (Glc-6-P) (Paneque et al., 2023). GlcNAc-6-P is two enzymatic steps from UDP-GlcNAc, which is the starting material for both O- and N-linked glycosylation, as well as chitin formation. It is possible that the loss of GlcNAc-6-P deacetylase might cause an excess of GlcNAc-6-P, and thus an excess UDP-GlcNAc. Because UDP-GlcNAc is such a keystone molecule in multiple pathways, there is no shortage of potential mechanisms: Tyrosine Hydroxylase is regulated by O-linked glycosylation (da Costa Rodrigues et al., 2025); in Drosophila, loss of the hippo signaling pathway causes excess cuticle pigmentation (Gibson et al., 2025), and the kinase in the middle of the pathway (warts) has a human ortholog, LATS1 (Large Tumor Suppressor Kinase 1) that is regulated by O-linked glycosylation (Meng et al., 2026); and a different enzyme in the hexosamine biosynthesis pathway is required for mouse and human hair pigmentation (Tiede et al., 2021). Future experiments with melanized in cuticle pigmentation (such as mosaics to determine autonomy), the protein glycosylation pathways (such as looking for genetic interactions with mutations in the N- or O-linked pathways), and the chitin biosynthesis pathways (testing chitin composition, for example) should provide answers for how loss of the GlcNAc-6-P deacetylase can cause the melanized phenotype.
","references":[{"reference":"Chovnick A, Finnertty V, Schalet A, Duck P. 1969. Studies on genetic organization in higher organisms. I. Analysis of a complex gene in Drosophila melanogaster. Genetics 62(1): 145-60.
","pubmedId":"5371011","doi":""},{"reference":"da Costa Rodrigues B, Dos Santos Lucena MC, Costa ACR, de Araújo Oliveira I, Thaumaturgo M, Paes-Colli Y, et al., Dias WB. 2025. O-GlcNAcylation regulates tyrosine hydroxylase serine 40 phosphorylation and l-DOPA levels. Am J Physiol Cell Physiol 328(3): C825-C835.
","pubmedId":"39870381","doi":""},{"reference":"Deal SL, Bei D, Gibson SB, Delgado-Seo H, Fujita Y, Wilwayco K, et al., Yamamoto S. 2026. RNAi-based screen for pigmentation in Drosophila melanogaster reveals regulators of brain dopamine and sleep. iScience 29(1): 114388.
","pubmedId":"41561374","doi":""},{"reference":"Dean DM, Deitcher DL, Paster CO, Xu M, Loehlin DW. 2022. \"A fly appeared\": sable, a classic Drosophila mutation, maps to Yippee, a gene affecting body color, wings, and bristles. G3 (Bethesda) 12(5): 10.1093/g3journal/jkac058.
","pubmedId":"35266526","doi":""},{"reference":"Fahmy, O.G., Fahmy, M. 1958. New mutants report. Drosophila Information Service 32: 67–78.
","pubmedId":"","doi":""},{"reference":"Gibson SB, Deal SL, Park YJ, Sun B, Qi Y, Mok JW, et al., Yamamoto S. 2025. Hippo signaling regulates cuticle pigmentation and dopamine metabolism in Drosophila. bioRxiv: pii: 2025.11.13.688152. 10.1101/2025.11.13.688152.
","pubmedId":"41292750","doi":""},{"reference":"Gloor, G., Engels, W. 1992. Single-fly DNA preps for PCR. Drosophila Information Service 71: 148–149.
","pubmedId":"","doi":""},{"reference":"Han Q, Fang J, Ding H, Johnson JK, Christensen BM, Li J. 2002. Identification of Drosophila melanogaster yellow-f and yellow-f2 proteins as dopachrome-conversion enzymes. Biochem J 368(Pt 1): 333-40.
","pubmedId":"12164780","doi":""},{"reference":"Kanca O, Zirin J, Hu Y, Tepe B, Dutta D, Lin WW, et al., Bellen HJ. 2022. An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination. Elife 11: 10.7554/eLife.76077.
","pubmedId":"35723254","doi":""},{"reference":"Kroef V, Ruegenberg S, Horn M, Allmeroth K, Ebert L, Bozkus S, et al., Denzel MS. 2022. GFPT2/GFAT2 and AMDHD2 act in tandem to control the hexosamine pathway. Elife 11: 10.7554/eLife.69223.
","pubmedId":"35229715","doi":""},{"reference":"Meng L, Wang Y, Zhou W, Wu S, Li J. 2026. O-GlcNAcylation of the tumor suppressor LATS1 drives mitotic progression via PLK1. J Biol Chem 302(1): 110990.
","pubmedId":"41338457","doi":""},{"reference":"Miklos, G. L. G., Kramers, P. G. N., & Schalet, A. P. 1986. The proximal-distal orientation of two lethal complementation groups A112 and LB20 in region 19F at the base of the X chromosome. Drosophila Information Service 63: 96–97.
","pubmedId":"","doi":""},{"reference":"Paneque A, Fortus H, Zheng J, Werlen G, Jacinto E. 2023. The Hexosamine Biosynthesis Pathway: Regulation and Function. Genes (Basel) 14(4): 10.3390/genes14040933.
","pubmedId":"37107691","doi":""},{"reference":"Richardt A, Kemme T, Wagner S, Schwarzer D, Marahiel MA, Hovemann BT. 2003. Ebony, a novel nonribosomal peptide synthetase for beta-alanine conjugation with biogenic amines in Drosophila. J Biol Chem 278(42): 41160-6.
","pubmedId":"12900414","doi":""},{"reference":"Riedel F, Vorkel D, Eaton S. 2011. Megalin-dependent yellow endocytosis restricts melanization in the Drosophila cuticle. Development 138(1): 149-58.
","pubmedId":"21138977","doi":""},{"reference":"Sickmann, M., Gohl, D. M., Affolter, M., & Muller, M. 2017. The Drosophila melanogaster straw locus is allelic to laccase2. Drosophila Information Service 100: 171–174.
","pubmedId":"","doi":""},{"reference":"Spana EP, Abrams AB, Ellis KT, Klein JC, Ruderman BT, Shi AH, et al., May S. 2020. speck, First Identified in Drosophila melanogaster in 1910, Is Encoded by the Arylalkalamine N-Acetyltransferase (AANAT1) Gene. G3 (Bethesda) 10(9): 3387-3398.
","pubmedId":"32709620","doi":""},{"reference":"Tiede S, Hundt JE, Paus R. 2021. UDP-GlcNAc-1-Phosphotransferase Is a Clinically Important Regulator of Human and Mouse Hair Pigmentation. J Invest Dermatol 141(12): 2957-2965.e5.
","pubmedId":"34116066","doi":""},{"reference":"Wright TR. 1987. The genetics of biogenic amine metabolism, sclerotization, and melanization in Drosophila melanogaster. Adv Genet 24: 127-222.
","pubmedId":"3124532","doi":""},{"reference":"Yamamoto S, Seto ES. 2014. Dopamine dynamics and signaling in Drosophila: an overview of genes, drugs and behavioral paradigms. Exp Anim 63(2): 107-19.
","pubmedId":"24770636","doi":""}],"title":"The melanized (mel) locus of Drosophila melanogaster is a mutation in CG17065, an N-acetylglucosamine-6-phosphate deacetylase
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"c83a25a7-4f91-49bf-aab2-ec9f9f486c1f","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}