Corrigendum for microPublication Lins et al., 2023 https://www.micropublication.org/journals/biology/micropub-biology-000693
The authors of the above-noted microPublication submit the following corrections.
After publication, it was determined that the humanized-control hTARDBP transgene and other mutant versions of hTARDBP contain a duplication, which arose during the second genome-editing step. These duplications were detected using PCR primers and were confirmed by sequencing. These duplications prevent stable expression of the encoded protein.
The only hTARDBP transgene that was assembled correctly is in strain HA4006 called tdp-1(tgx286tgx416), which contains the A315T mutation, and is accurately described in the original microPublication.
The precise deletion loss-of-function allele, tdp-1(tgx58) in strain HA3703, has been confirmed and is also accurately described in the original microPublication.
Conclusions have not changed regarding results in Panels G, H and I comparing the deletion allele tdp-1(tgx58) to wild type animals (N2). And, conclusions have not changed regarding results in Panel I, which compare tdp-1(tgx286tgx416) A315T to the deletion loss-of-function allele tdp-1(tgx58) and to wild type animals (N2 strain).
No conclusions should be drawn from results in Panels H & I regarding the mis-assembled humanized-control hTARDBP transgene or the other mutant versions of hTARDBP.
These changes have not been applied to the published article.
","date":"Wed Jun 03 2026","correctionType":"corrigendum"}],"versions":[{"id":"e0efac95-0e5b-4391-af65-bf7fd6db8209","decisionLetter":"Dear Anne Hart,
Your article \"Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants.\" has been accepted, with minor modifications.
You can find the reviewer's and curator's comments below.
We kindly ask you to address each point and summarize your changes in line with the reviewer's response in the 'Comments to Editor' section on the platform. In order to expedite the processing of your revised manuscript, please be as specific as possible in your responses.
The microPublication Editorial Team
Reviewer's response:
The work by Lins and coworkers is a very nice focused genetics approach to investigate C. elegans tdp-1 function along with humanized TDP-43 variants. This work is of interest given the association of TDP-43 to ALS-FTD, but also for the basic biology of tdp-1, here with a focus on neurodegeneration. The methods are well detailed and will be of general interest. Also interesting that not all variants linked to human disease show a phenotype, albeit, in one assay.
Minor points to address/correct.
Frontotemporal Dementia and Amyotrophic Lateral Sclerosis should not be capitalized (the abbreviations are fine, of course).
Sentence “For the remaining alleles (G294A, G298S, A315T, and M337V) no increases from hTARDBP-WT were observed using this stress-induced neurodegeneration assay.” Should be re-written, is a little awkward - no increased neurodegeneration compared to WT, or the remaining alleles were not significantly different that WT, etc.
Any speculation on why only one variant showed neurodegeneration?
~~~~~~~~~~~~
Curator's comments:
1. Authors should indicate in the experimental details what elegans strain they used in addition or in conjunction (next to) names such as \"hTARDBP\" and \"hTARDBP M337V\"; authors can indicate this in the Fig. 1 text/explanation if its hard to put it on the figure itself. These kinds of practices increases curation efficiency as curators then don't have to go back and forth to see what strain name maps to what variant/genotype.
2. I'm assuming that the column labeled \"outcrossed strain\" is what they used in experiments; but would be clearer if authors said this as well somewhere.
3. Authors should remove all in-text citation links to their references
4. should nmx58 by tgx58 in \"Genome editing: The tdp-1(nmx58) KO allele was...\"?
5. Should \"We used co-CRISPR editing to insert the five ALS/FTD clinical variants...\" be \"We used co-CRISPR editing to insert each of the five ALS/FTD clinical variants...\" otherwise it sounds like all five variants were inserted into one line.
","decision":"revise","submitted":true,"abstract":"Clinical variants of TARDBP are associated with Frontotemporal Dementia (FTD), Amyotrophic Lateral Sclerosis (ALS) and other degenerative diseases. The predicted C. elegans ortholog of TARDBP is encoded by tdp-1, but functional orthology has not been demonstrated in vivo. We undertook CRISPR/Cas9-based genome editing of the tdp-1 locus to create a complete loss of function allele; all tdp-1 exons and introns were deleted, creating tdp-1(tgx58), which resulted in neurodegeneration after oxidative stress. Next, we undertook CRISPR-based genome editing to replace tdp-1 exons with human TARDBP coding sequences, creating humanized (hTARDBP) C. elegans expressing TDP-43. Based on the efficiency of this genome editing, we suggest that iterative genome editing of the tdp-1 target locus using linked coCRISPR markers, like dpy-10, would be a more efficient strategy for sequential assembly of the large engineered transgenes. hTARDBP decreased the neurodegeneration defect of tdp-1(tgx58), demonstrating functional cross-species orthology. To develop C. elegans models of FTD and ALS, we inserted five different patient TARDBP variants in the C. elegans hTARDBP locus. Only one clinical variant increased stress-induced neurodegeneration; other variants caused inconsistent or negligible defects under these conditions. Combined, this work yielded an unambiguous null allele for tdp-1, a validated, humanized hTARDBP, and multiple ALS/FTD patient-associated variant models that can be used for future studies.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).","authors":[{"affiliations":["Department of Neuroscience, Brown University, Providence, RI 02912"],"credit":["writing_reviewEditing","investigation"],"email":"jeremy_lins@brown.edu","firstName":"Jeremy","lastName":"Lins","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":null},{"affiliations":["InVivo Biosystems, Eugene, OR, 79402"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","writing_originalDraft","writing_reviewEditing"],"email":"trisha.brock@invivobiosystems.com","firstName":"Trisha J","lastName":"Brock","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":"0000-0003-4540-0123"},{"affiliations":["InVivo Biosystems, Eugene, OR, 79402"],"credit":["conceptualization","fundingAcquisition","methodology","project","supervision","writing_originalDraft","writing_reviewEditing"],"email":"chris.hopkins@invivobiosystems.com","firstName":"Chris E","lastName":"Hopkins","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":"0000-0003-4540-0123"},{"affiliations":["Department of Neuroscience, Brown University, Providence, RI 02912"],"credit":["conceptualization","fundingAcquisition","methodology","project","supervision","writing_originalDraft","writing_reviewEditing"],"email":"anne_hart@brown.edu","firstName":"Anne","lastName":"Hart","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7239-4350"}],"comments":"","dataTable":null,"disclaimer":true,"funding":"Supported by NIH R43 AG061978-01","image":{"name":"TARDBP FIGURE FINAL.png","url":"https://portal.micropublication.org/uploads/c4c8276806dfafb5fac02578d9b82034.png"},"imageCaption":"
A. Strategy for genome editing. A wild type (N2, white) animal is CRISPR-edited to make a knock-out (KO, red) animal. When loss-of-function defects are detected in the KO, the gene is humanized (blue); wild type C. elegans exons and introns are excised and replaced with human coding sequences. Finally, another round of CRISPR-editing is undertaken to insert clinical variants (grey) into the humanized locus. Comparison of the N2 and KO permits detection of loss of function defects. Comparison of these with the humanized-control reveals functional orthology by rescue, and comparison to patient-associated allele lines allows detection of variant defects.
B. Knock out of tdp-1 locus. Creation of a tdp-1 KO null allele by CRISPR-editing required deleting sequences (red) containing exons and introns (grey boxes and intervening lines).
C. Human gene replacement at tdp-1 locus. CRISPR-editing was used to remove endogenous coding sequences and insert human gene coding sequences to create hTADRBP, containing artificial introns (blue exon boxes linked by orange artificial intron line).
D. Cis editing predominates. A CRISPR-editing approach was used to insert hTARDBP sequences into the tdp-1 locus (black), which is closely linked to the dpy-10 locus (grey). These loci are ~2 centiMorgans apart. At the co-CRISPR marker dpy-10 locus, one allele was converted to dpy-10(cn64) and the other allele was unedited (hemi-converted); the resulting Roller heterozygotes were selected (green). Co-conversion of the tdp-1 target locus with hTARDBP fragment insertion occurred only on the cis strand (blue).
E. Iterative assembly using linked alleles. Target genes that are tightly linked to a coCRISPR marker can be iteratively co-CRISPR-edited to build large transgenes by flip-flop selection procedure. In this example, the dpy-10 locus is co-CRISPR converted to yield dpy-10(cn64) (green) and conversion of the linked locus to contain a gene fragment content (dark blue) in the first step. In the second step, using the Dumpy animals from the first step, a repeat round of co-CRISPR restores dpy-10(wt) (grey) simultaneously with insertion of another gene fragment (light blue). Repeat rounds of co-CRISPR using the Dumpy and nonDumpy phenotypes allows iterative editing of the target locus and efficient sequential build up of a large gene assembly (additional blue boxes).
F. Assessing neurodegeneration. C. elegans phasmid neurons take up fluorescent lipophilic dyes via exposed sensory endings. Sensory ending defects, process retraction or neuron loss can cause dye-filling defects.
G. Mild stress with 2.5mM paraquat for 22 hours does not cause dye filling defects in N2 (white), WT hTARDBP (blue), or tdp-1(-) animals (grey). Three independent trials; 20 animals per genotype per trial.
H. Moderate stress with 10mM paraquat for 22 hours causes dye filling defects in tdp-1(tgx58) loss of function animals (lof, red) that exceed defects observed in N2 animals (white) or WT hTARDBP animals (blue). Twelve independent trials; 20 animals per genotype per trial.
I. Patient variants inserted into hTARDBP Generation of patient variants M337V, A315T, G298S, and G294A did not result in moderate stress-induced dye filling defects, only G295S differed from hTARDBP. Three independent trials with 20 animals per genotype per trial; hash marks on X-axis group separate genotypes assayed simultaneously. Note that the experimental results shown in Panel G for N2, hTARDBP and tdp-1(-) are the same experimental results as shown in Panel F; results are consolidated in Panel F for ease of presentation.
","imageTitle":"Humanizing tdp-1 to determine if patient variants cause stress-induced neurodegeneration
","laboratory":{"name":"HA","WBId":""},"methods":"Neurodegeneration: L4 stage animals were moved to NGM/OP50 plates containing 10mM (or 2.5mM) paraquat for 22 hours and neurodegeneration was examined the next day in adults based on backfilling of phasmids neurons with DiI (Molecular Probes). Animals were scored as affected if any of the four phasmid neurons failed to backfill with fluorescent dye, detected at a magnification level of 12.5x with moving animals on culture dishes; note that loss of a single neuron will be missed in some animals and we may underestimate neurodegeneration. Animals were scored blinded as to genotype.
Genome editing: The tdp-1(nmx58) KO allele was generated by deletion of the coding sequence using CRISPR/Cas9-mediated homologous recombination. The dpy-10 co-conversion strategy was used to identify candidate lines after injection (Arribere et al. 2014). Two guide RNAs (sgRNAs) were selected, one in the first tdp-1 coding exon and the other after the stop codon creating a 1787bp deletion. All sgRNAs were synthesized by Synthego Corporation (Redwood City, CA). The donor homology sequence was a single stranded oligonucleotide (ssODN) containing 35bp homology arms, a 3-frame stop sequence, and an XhoI restriction site (reagent table). Injections of the Cas9 protein, sgRNAs, and donor homology template mix were performed with N2 young adults. Genome edit candidates were selected from the F1 population based on a visual screen for the co-conversion Rol phenotype and screened by PCR for the deletion. Homozygous deletion lines were confirmed by sequencing.
The hTARDBP-WT insertion was generated using a gene swap method (McCormick et al. 2021) with modifications to use PCR products as the donor homology template through sequential rounds of editing. The first insertion used the dpy-10 co-conversion CRISPR/Cas9 strategy to insert 725bp of the hTARDBP sequence. The injection mix included Cas9 protein, the 795bp dsDNA donor homology template, sgRNAs, and co-CRISPR reagents. This was injected into the gonads of adult hermaphrodite worms and the F1 animals displaying the co-CRISPR phenotype were isolated. Homozygous animals containing the insertion were identified; however, they also contained the dpy-10(cn64) mutation. An edit to correct this mutation was performed and animals with wild type sequence at the dpy-10 locus, but containing the partial hTARDBP-WT were identified. This strain was injected with the 756bp PCR product donor homology template containing the second half of the hTARDBP sequence and homology arms, along with the Cas9 protein, sgRNAs, and the dpy-10 co-CRISPR reagents. Animals homozygous for the insertion as well as the spy-10(cn64) mutation were isolated and the corrective edit for dpy-10 was performed. Integration of the complete sequence of hTARDBP was confirmed by Sanger sequence analysis. When complete, the hTARDBP-WT strain contained a codon optimized version (Redemann et al. 2011) of 414 amino acid hTARDBP with 3 synthetic introns. Note that hTARDBP was introduced into the native tdp-1 exon 1 such that the first 5 native C. elegans amino acids were preserved (i.e. MADET). Verification hTARDBP mRNA expression was undertaken. RNA was extracted from the hTARDBP-WT strain and N2 using TRI Reagent and the Direct-zol RNA kit (Zymo Research and cDNA was synthesized using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories). To amplify the whole coding sequence, PCR was performed, see reagent table for primers, on the cDNA and visualized on an agarose gel. The full length hTARDBP sequence amplified from the humanized strain at a comparable level to tdp-1 in N2. The amplicons were also used as a template for DNA sequencing by Sequetech Corporation. Sequences were aligned and analyzed using Benchling and full-length hTARDBP was observed.
The hTARDBP variants were inserted using CRISPR/Cas9-mediated homologous recombination. For each variant, two sgRNAs flanking the desired edit were selected. The donor homology was designed with 35bp homology arms and re-coding to eliminate recutting of the repaired template and to make identification of the edits easier. The injection mixes included Cas9 protein, each donor homology single-stranded oligonucleotide (ssODN), the sgRNAs, and the dpy-10 co-CRISPR reagents. Animals displaying the co-CRISPR phenotype were selected and High Resolution Melt Analysis was performed to identify animals containing the edit of interest. Homozygous animals were isolated and confirmed by sequencing of both the target locus and the dpy-10 locus.
Statistical analysis: Student’s t-test used for comparison of neurodegeneration (Microsoft Excel).
","reagents":"gene | outcrossed strain | origin strain | genotype | source |
This study | ||||
hTARDBP(wt) | This study | |||
hTARDBP(G295S) | tdp-1(tgx286tgx359 [humanTARDBP G295S]) II | This study | ||
hTARDBP(G298S) | tdp-1(tgx286tgx371 [humanTARDBP G298S]) II | This study | ||
hTARDBP(G294A) | tdp-1(tgx286tgx382 [humanTARDBP G294A]) II | This study | ||
hTARDBP(A315T) | tdp-1(tgx286tgx416 [humanTARDBP A315T]) II | This study | ||
hTARDBP(A315T) | tdp-1(tgx286tgx417 [humanTARDBP A315T]) II | This study | ||
hTARDBP(M337V) | tdp-1(tgx286tgx400 [humanTARDBP M337V]) II | This study |
reference | sgRNA 1 | sgRNA 2 | ssODN sequence or plasmid name |
tdp-1(-) | AATGGCCGACGAAACGCCGA | CGTCGACATGAAAATTGTAG | ATCTGTTTCCAGTCACTAAATGGCCGACGAAACGCTAAATAAATAAACTCGAGCAATTTTCATGTCGACGCACTTTGCGATTTTATGC |
hTARDBP(wt) part 1 | AATGGCCGACGAAACGCCGA | CCGGTCGATCACGTTCTCTG | tatctgtttccagTCACTAAATGGCCGACGAAACGATGTCCGAGTACATCCGTGTCACGGAGGATGAAAACGACGAGCCAATCGAGATCCCATCCGAGGACGACGGAACCGTCCTCCTCTCCACCGTCACCGCCCAATTCCCAGGAGCCTGCGGACTCCGTTACCGTAACCCAGTCTCCCAATGCATGCGTGGAGTCCGTCTCGTCGAGGGAATCCTCCACGCCCCAGACGCCGGATGGGGAAACCTCGTCTACGTCGTCAACTACCCAAAGGACAACAAGCGTAAGATGGACGAGACCGACGCCTCCTCCGCCGTCAAAGTCAAGCGTGCCGTCCAAAAGgtgagttattataatttttttgatcacaacgattattttaattttcagACCTCGGACCTCATAGTGCTCGGACTCCCATGGAAGACCACCGAGCAAGACCTCAAGGAGTACTTCTCCACCTTCGGAGAGGTCCTCATGGTCCAAGTCAAGAAGGACCTCAAGACCGGACACTCCAAGGGATTCGGATTCGTCCGTTTCACCGAGTACGAGACCCAAGTCAAGGTCATGTCCCAACGTCACATGATCGACGGACGTTGGTGCGACTGCAAGCTCCCAAACTCCAAGCAATCCCAAGACGAGCCACTCCGTTCCAGGAAGgttaaatgtacaaacaactatttgaaagattttctcacccgattttttcagGTCTTCGTCGGACGTTGCACCGAGGACATGACCGAGGACGAGCTCCGTGAAGAACGTGATCGACCGGATAGACGACCGATTCAAA |
hTARDBP(wt) part 2 | TTGCACCGAGGACATGACCG | GAGACTCGAGAGGACCAGGA | tcagGTCTTCGTCGGACGTTGCACCGAGGACATGACTGAAGATGAACTTAGAGAGTTCTTCTCCCAATACGGAGACGTCATGGACGTCTTCATCCCAAAGCCATTCCGTGCCTTCGCCTTCGTCACCTTCGCCGACGACCAAATCGCCCAATCCCTCTGCGGAGAGGACCTCATCATCAAGgtaaataattatacattcgatgataaatttatgcgtactatttttcagGGAATCTCCGTCCACATCTCCAACGCCGAGCCAAAGCACAACTCCAACCGTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCGGGGGGATTCGGAAACCAAGGAGGGTTCGGGAACTCCCGTGGAGGAGGAGCCGGACTCGGGAACAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCGGAGCCTTCTCCATCAACCCAGCCATGATGGCCGCCGCCCAAGCCGCCCTCCAATCCTCCTGGGGAATGATGGGAATGCTCGCCTCCCAACAAAACCAATCCGGACCATCCGGAAACAACCAAAATCAGGGGAACATGCAACGTGAGCCAAACCAAGCCTTCGGATCGGGGAACAACTCCTACTCCGGATCCAACTCCGGAGCCGCCATCGGATGGGGATCCGCCTCCAACGCGGGGTCCGGATCCGGGTTCAACGGAGGATTCGGATCCTCCATGGACTCCAAGTCCTCCGGATGGGGAATGTAAGGATGGTGATTCTCTCGAAAAATCGTTATTATTCA |
hTARDBP(G295S) | GACGTTTCGGAGGAAACCCG | GCCGGACTCGGGAACAACCA | GTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCAGGTGGTTTCGGTAACCAGGGTGGTTTTGGCAATTCAAGGGGATCTGGAGCAGGTCTTGGTAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(G298S) | GGAACGCTCGAGTTGACGGT | GCCGGACTCGGGAACAACCA | CATCTCCAACGCCGAGCCAAAGCACAACTCCAACAGACAGCTTGAACGCTCTGGAAGATTCGGTGGTAATCCGGGAGGTTTCGGTAATCAGGGTGGTTTCGGTAACTCTAGAGGCGGTGGAGCTTCTCTTGGAAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(G294A) | GACGTTTCGGAGGAAACCCG | GCCGGACTCGGGAACAACCA | GTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCAGGAGGTTTTGGTAATCAAGGTGGATTTGGAAATTCTAGAGCTGGTGGTGCTGGTTTAGGTAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(A315T) | GCCGGACTCGGGAACAACCA | TTGGAGGGCGGCTTGGGCGG | AACTCCCGTGGAGGAGGAGCCGGACTCGGGAACAACCAAGGCTCTAATATGGGCGGCGGCATGAATTTTGGAACCTTTTCTATTAATCCCGCTATGATGGCTGCTGCCCAAGCCGCCCTCCAATCCTCCTGGGGAATGATG |
hTARDBP(M337V) | TTGGAGGGCGGCTTGGGCGG | GCCAAACCAAGCCTTCGGAT | AGCCTTCTCCATCAACCCAGCCATGATGGCCGCCGCTCAGGCTGCTCTTCAATCTTCTTGGGGTATGGTTGGTATGCTTGCTTCTCAACAGAACCAGTCTGGTCCGTCTGGTAATAACCAGAACCAAGGGAATATGCAGCGCGAACCAAATCAGGCTTTTGGATCGGGGAACAACTCCTACTCCGGATCCAACTCC |
dpy-10(wt) | CTCGTGGTGCCTATGGTAGC | CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCTCGTGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT |
Primer name | Primer Sequence |
hTARDBP FWD (86) | GGAAACCTCGTCTACGTCGTCA |
hTARDBP REV (88) | ATCCGAATCCTCCGTTGAACCC |
tdp-1 FWD (87) | CCGACGAAACGCCGAAGG |
tdp-1 REV (89) | GTCTCCAGGTGCCCAGTATCTC |
reagent | source |
1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate (DiI) | Molecular Probes |
XhoI (cat#R0146L) | New England Biochemicals |
Cas9 protein with NLS, high concentration (cat#CP02) | PNA Bio |
TRI Reagent (cat#R2050-1-200) | Zymo Research |
Direct-zol RNA Miniprep (cat#R2052) | Zymo Research |
iScript™ Reverse Transcription Supermix for RT-qPCR (cat#1708840) | Bio-Rad Laboratories |
Patient variants in TARDBP, which encodes the RNA-binding protein TDP-43, are associated with a wide variety of degenerative disorders(REF). These include Frontotemporal Dementia (FTD) which leads to degeneration and death of cortical neurons, as well as Amyotrophic Lateral Sclerosis (ALS), which leads to degeneration and death of spinal and cortical motor neurons. The C. elegans ortholog of TARDBP is TAR DNA-binding Protein homolog-1, known as tdp-1. To enable studies of TDP-1 function, and to demonstrate functional homology between TDP-1 and TARDBP, as well as to examine how patient-associated missense variants alter protein function in live animals, we undertook several rounds of CRISPR/Cas9-based genome deletion, humanization, and variant generation (Panels A, B and C), with a focus on generating reagents and assessing neurodegeneration.
Knock out. First, we created a tdp-1 loss of function allele by precise excision using CRISPR-editing. Using CRISPR/Cas9-mediated homologous recombination and dpy-10 co-conversion (Arribere et al. 2014), we designed a knockout (KO) that would remove all tdp-1 coding exons, as well as introns (Panel B) resulting in an unequivocal complete loss of function allele. When generating tdp-1 KOs, we observed robust co-conversion of the dpy-10 and tdp-1 loci on the same maternal chromosome (Panel D), as expected from previous work (Medley et al. 2022). However we also observed biallelic conversion of the sister chromosome, as seen previously (Kim et al. 2014), which allowed us to isolate the tdp-1(tgx58) deletion as homozygote, free of the Dumpy phenotype marker.
Assess neurodegeneration for tdp-1(lof) To determine if loss of tdp-1 function in C. elegans leads to degeneration and/or loss of neurons, we examined stress-induced degeneration of glutamatergic sensory neurons. PHA and PHB neurons are bilaterally-symmetric phasmid neurons in the C. elegans tail that have exposed sensory endings (Panel F). Degenerative retraction of phasmid neuron sensory processes or phasmid neuron death can prevent fluorescent dye back-filling of the entire neuron. This assay has been used previously in C. elegans models of neurodegenerative disease (Faber et al. 1999; Baskoylu et al. 2018; Ryan et al. 2020). Hypersensitivity to stress can reveal latent defects in C. elegans models of neurodegenerative disease (Baskoylu et al. 2018; Nass et al. 2002). Noting reports that perturbation of tdp-1 function causes hypersensitivity to oxidative stress (Vaccaro, Tauffenberger, Ash, et al. 2012), we compared wild type animals to tdp-1(tgx58) animals at two concentrations of paraquat. Mild paraquat stress overnight had no impact on neurodegeneration in the dye filling assay in either wild type or tdp-1(tgx58) young adult animals (Panel G, 22 hours, 2.5mM paraquat). However, 10mM paraquat-treatment overnight led to modest dye filling defects in wild type with more dramatic defects in tdp-1(tgx58) animals (Panel H, 22 hours, 10mM paraquat). These results confirm that tdp-1 loss of function increases neurodegeneration under moderate oxidative stress.
Humanize and insert clinical variants. With a KO phenotype established, we used two serial rounds of co-CRISPR editing (Arribere et al. 2014) to insert sequences encoding human TARDBP as a replacement of the tdp-1 coding sequence (Panel C). For this humanized construct, we focused on expressing the most abundant isoform of TARDBP (UNIPROT Q13148-1) re-coded for C. elegans codon bias and with the insertion of three synthetic introns. A full length plasmid containing a synthetic TARDBP sequence could not be generated by our suppliers. As an alternative, we elected to consecutively insert two fragments of TARDBP using co-CRISPR-editing. Insertion of the first fragment of recoded TARDBP resulted only in cis co-editing events (target edit occuring on same strand as selection marker, Panel D); all animals homozygous for the intended tdp-1 edit were also Dumpy (homozygous for dpy-10(cn64)). To move hTARDBP to a wild type background, we undertook an additional round of CRISPR-editing to restore the original N2 wild type dpy-10 sequence (dpy-10(wt)). Another round of co-CRISPR to insert the second fragment of recoded TARDBP also resulted in only cis co-editing and all animals homozygous for full length TARDBP were also Dumpy. Again, a round of repair CRISPR was used to restore the dpy-10 locus back to nonDumpy (original N2 sequence, wild type phenotype).
The observation of cis-only editing with the co-generation of dpy-10 alleles, followed by a need to repair to get back to wildtype phenotype, leads us to suggest that future studies should use a serial-editing strategy to build up a large gene with a “flip-flop approach” that alternates between Dumpy and nonDumpy animals (Panel E).
Expression of full length hTARDBP was confirmed by rtPCR and the LOF defect of tdp-1(-) was partially rescued in the hTARDBP animals. (Panel H). We used co-CRISPR editing to insert the five ALS/FTD clinical variants into the humanized locus (G294A, G295S, G298S, A315T, and M337V). Over-expression of TARDBP A315T is toxic in two different C. elegans models and TARDBP M337V is toxic in two different C. elegans models (Vaccaro, Tauffenberger, Aggad, et al. 2012; Liachko, Guthrie, and Kraemer 2010; Zhang et al. 2012). C. elegans models for the other alleles have not been reported previously.
Assess neurodegeneration for clinical variants Only insertion of hTARDBP-G295S yielded a significant defect versus hTARDBP-WT (Panel I). Future work will likely require confirmation of the G295S defect with the generation and testing of another independently-derived allele. For the remaining alleles (G294A, G298S, A315T, and M337V) no increases from hTARDBP-WT were observed using this stress-induced neurodegeneration assay.
","references":[{"reference":"Arribere JA, Bell RT, Fu BX, Artiles KL, Hartman PS, Fire AZ. 2014. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics 198: 837-46.
","pubmedId":"25161212","doi":""},{"reference":"Baskoylu SN, Yersak J, O'Hern P, Grosser S, Simon J, Kim S, et al., Hart AC. 2018. Single copy/knock-in models of ALS SOD1 in C. elegans suggest loss and gain of function have different contributions to cholinergic and glutamatergic neurodegeneration. PLoS Genet 14: e1007682.
","pubmedId":"30296255","doi":""},{"reference":"Faber PW, Alter JR, MacDonald ME, Hart AC. 1999. Polyglutamine-mediated dysfunction and apoptotic death of a Caenorhabditis elegans sensory neuron. Proc Natl Acad Sci U S A 96: 179-84.
","pubmedId":"9874792","doi":""},{"reference":"Kim H, Ishidate T, Ghanta KS, Seth M, Conte D Jr, Shirayama M, Mello CC. 2014. A co-CRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197: 1069-80.
","pubmedId":"24879462","doi":""},{"reference":"Liachko NF, Guthrie CR, Kraemer BC. 2010. Phosphorylation promotes neurotoxicity in a Caenorhabditis elegans model of TDP-43 proteinopathy. J Neurosci 30: 16208-19.
","pubmedId":"21123567","doi":""},{"reference":"McCormick, Kathryn, Trisha Brock, Matthew Wood, Lan Guo, Kolt McBride, Christine Kim, Lauren Resch, et al. 2021. “A Gene Replacement Humanization Platform for Rapid Functional Testing of Clinical Variants in Epilepsy-Associated STXBP1.” bioRxiv. https://doi.org/10.1101/2021.08.13.453827.
Medley JC, Hebbar S, Sydzyik JT, Zinovyeva AY. 2022. Single nucleotide substitutions effectively block Cas9 and allow for scarless genome editing in Caenorhabditis elegans. Genetics 220: .
","pubmedId":"34791245","doi":""},{"reference":"Nass R, Hall DH, Miller DM 3rd, Blakely RD. 2002. Neurotoxin-induced degeneration of dopamine neurons in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99: 3264-9.
","pubmedId":"11867711","doi":""},{"reference":"Redemann S, Schloissnig S, Ernst S, Pozniakowsky A, Ayloo S, Hyman AA, Bringmann H. 2011. Codon adaptation-based control of protein expression in C. elegans. Nat Methods 8: 250-2.
","pubmedId":"21278743","doi":""},{"reference":"Ryan VH, Perdikari TM, Naik MT, Saueressig CF, Lins J, Dignon GL, et al., Fawzi NL. 2021. Tyrosine phosphorylation regulates hnRNPA2 granule protein partitioning and reduces neurodegeneration. EMBO J 40: e105001.
","pubmedId":"33349959","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Aggad D, Rouleau G, Drapeau P, Parker JA. 2012. Mutant TDP-43 and FUS cause age-dependent paralysis and neurodegeneration in C. elegans. PLoS One 7: e31321.
","pubmedId":"22363618","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Aggad D, Rouleau G, Drapeau P, Parker JA. 2012. Mutant TDP-43 and FUS cause age-dependent paralysis and neurodegeneration in C. elegans. PLoS One 7: e31321.
","pubmedId":"22363618","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Ash PE, Carlomagno Y, Petrucelli L, Parker JA. 2012. TDP-1/TDP-43 regulates stress signaling and age-dependent proteotoxicity in Caenorhabditis elegans. PLoS Genet 8: e1002806.
","pubmedId":"22792076","doi":""},{"reference":"Zhang T, Hwang HY, Hao H, Talbot C Jr, Wang J. 2012. Caenorhabditis elegans RNA-processing protein TDP-1 regulates protein homeostasis and life span. J Biol Chem 287: 8371-82.
","pubmedId":"22232551","doi":""}],"suggestedReviewer":{"name":"Todd Lamitina, Aimee Kao, Brian Kraemer, John Pierce, Alex Parker","WBId":""},"title":"Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants.
","reviews":[{"reviewer":{"displayName":"Alex Parker"},"openAcknowledgement":true,"status":{"submitted":true}}]},{"id":"49af384c-3fb9-4f6e-b1ff-ed1b39611fe1","decisionLetter":"Dear Anne C Hart,
We are happy to let you know that your article has been accepted for publication. Congratulations!
Please take a careful look at the production proofs of your article: proof download.
One thing we need you to address during the proofing stage is to define the p value of the * in panels H and I.
Please make sure there are no typos, errors or omissions in your article, including your title, author names, affiliations, reagents, etc. in addition to your reported results. These are little things that if wrong will still require a separate corrigendum article if they need correction after publication.
Please make any change or approve the current version by following this link.
Please return your corrections within 72 hours. If you are unable to return your corrections within 72 hours, let us know.
Please submit your payment here. If you are unable to submit your payment, require a waiver, or have any questions regarding billing please contact us at billing@micropublication.org.
Your invoice can be downloaded here.
Do not hesitate to contact us if you have any questions.
We look forward to publishing your work.
Best wishes,
The microPublication Editorial Team
","decision":"accept","submitted":true,"abstract":"Clinical variants of TARDBP are associated with frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS) and other degenerative diseases. The predicted C. elegans ortholog of TARDBP is encoded by tdp-1, but functional orthology has not been demonstrated in vivo. We undertook CRISPR/Cas9-based genome editing of the tdp-1 locus to create a complete loss of function allele; all tdp-1 exons and introns were deleted, creating tdp-1(tgx58), which resulted in neurodegeneration after oxidative stress. Next, we undertook CRISPR-based genome editing to replace tdp-1 exons with human TARDBP coding sequences, creating humanized (hTARDBP) C. elegans expressing TDP-43. Based on the efficiency of this genome editing, we suggest that iterative genome editing of the tdp-1 target locus using linked coCRISPR markers, like dpy-10, would be a more efficient strategy for sequential assembly of the large engineered transgenes. hTARDBP decreased the neurodegeneration defect of tdp-1(tgx58), demonstrating functional cross-species orthology. To develop C. elegans models of FTD and ALS, we inserted five different patient TARDBP variants in the C. elegans hTARDBP locus. Only one clinical variant increased stress-induced neurodegeneration; other variants caused inconsistent or negligible defects under these conditions. Combined, this work yielded an unambiguous null allele for tdp-1, a validated, humanized hTARDBP, and multiple ALS/FTD patient-associated variant models that can be used for future studies.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).","authors":[{"affiliations":["Department of Neuroscience, Brown University, Providence, RI 02912"],"credit":["writing_reviewEditing","investigation"],"email":"jeremy_lins@brown.edu","firstName":"Jeremy","lastName":"Lins","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":null},{"affiliations":["InVivo Biosystems, Eugene, OR, 79402"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","writing_originalDraft","writing_reviewEditing"],"email":"trisha.brock@invivobiosystems.com","firstName":"Trisha J","lastName":"Brock","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":"0000-0003-4540-0123"},{"affiliations":["InVivo Biosystems, Eugene, OR, 79402"],"credit":["conceptualization","fundingAcquisition","methodology","project","supervision","writing_originalDraft","writing_reviewEditing"],"email":"chris.hopkins@invivobiosystems.com","firstName":"Chris E","lastName":"Hopkins","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":"0000-0003-4540-0123"},{"affiliations":["Department of Neuroscience, Brown University, Providence, RI 02912"],"credit":["conceptualization","fundingAcquisition","methodology","project","supervision","writing_originalDraft","writing_reviewEditing"],"email":"anne_hart@brown.edu","firstName":"Anne C","lastName":"Hart","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7239-4350"}],"comments":"We appreciate the thoughtful comments and careful reading of the manuscript by the reviewers and curators. All corrections suggested have been incorporated into the revised manuscript.
Reviewer: Minor points to address/correct.
Frontotemporal Dementia and Amyotrophic Lateral Sclerosis should not be capitalized (the abbreviations are fine, of course).
Corrected
Sentence “For the remaining alleles (G294A, G298S, A315T, and M337V) no increases from hTARDBP-WT were observed using this stress-induced neurodegeneration assay.” Should be re-written, is a little awkward - no increased neurodegeneration compared to WT, or the remaining alleles were not significantly different that WT, etc.
Rephrased as “For the remaining alleles (G294A, G298S, A315T, and M337V), no significant increases in stress-induced neurodegeneration were observed, compared to hTARDBP-WT, using this assay.”
Any speculation on why only one variant showed neurodegeneration?
We do not wish to speculate why one allele shows a significant defect and the other alleles don’t.
~~~~~~~~~~~~
Curator's comments:
1. Authors should indicate in the experimental details what elegans strain they used in addition or in conjunction (next to) names such as \"hTARDBP\" and \"hTARDBP M337V\"; authors can indicate this in the Fig. 1 text/explanation if it is hard to put it on the figure itself. These kinds of practices increases curation efficiency as curators then don't have to go back and forth to see what strain name maps to what variant/genotype.
Strain designations were added to the figure legend to assist with curation. Example: “Strains used were HA4008 for M337V, HA4006 for A315T#1, HA4007 for A315T#2, HA4003 for G298S, HA4005 for G294A, HA3983 for G295S.”
2. I'm assuming that the column labeled \"outcrossed strain\" is what they used in experiments; but would be clearer if authors said this as well somewhere.
Clarified in the methods with the statement “Original, edited strains were backcrossed to N2 four times to create outcrossed strains, which were used to generate results presented herein.”
3. Authors should remove all in-text citation links to their references
Done
4. should nmx58 by tgx58 in \"Genome editing: The tdp-1(nmx58) KO allele was...\"?
Corrected.
5. Should \"We used co-CRISPR editing to insert the five ALS/FTD clinical variants...\" be \"We used co-CRISPR editing to insert each of the five ALS/FTD clinical variants...\" otherwise it sounds like all five variants were inserted into one line.
Corrected.
A. Strategy for genome editing. A wild type (N2, white) animal is CRISPR-edited to make a knock-out (KO, red) animal. When loss-of-function defects are detected in the KO, the gene is humanized (blue); wild type C. elegans exons and introns are excised and replaced with human coding sequences. Finally, another round of CRISPR-editing is undertaken to insert clinical variants (grey) into the humanized locus. Comparison of the N2 and KO permits detection of loss of function defects. Comparison of these with the humanized-control reveals functional orthology by rescue, and comparison to patient-associated allele lines allows detection of variant defects.
B. Knock out of tdp-1 locus. Creation of a tdp-1 KO null allele by CRISPR-editing required deleting sequences (red) containing exons and introns (grey boxes and intervening lines).
C. Human gene replacement at tdp-1 locus. CRISPR-editing was used to remove endogenous coding sequences and insert human gene coding sequences to create hTADRBP, containing artificial introns (blue exon boxes linked by orange artificial intron line).
D. Cis editing predominates. A CRISPR-editing approach was used to insert hTARDBP sequences into the tdp-1 locus (black), which is closely linked to the dpy-10 locus (grey). These loci are ~2 centiMorgans apart. At the co-CRISPR marker dpy-10 locus, one allele was converted to dpy-10(cn64) and the other allele was unedited (hemi-converted); the resulting Roller heterozygotes were selected (green). Co-conversion of the tdp-1 target locus with hTARDBP fragment insertion occurred only on the cis strand (blue).
E. Iterative assembly using linked alleles. Target genes that are tightly linked to a coCRISPR marker can be iteratively co-CRISPR-edited to build large transgenes by flip-flop selection procedure. In this example, the dpy-10 locus is co-CRISPR converted to yield dpy-10(cn64) (green) and conversion of the linked locus to contain a gene fragment content (dark blue) in the first step. In the second step, using the Dumpy animals from the first step, a repeat round of co-CRISPR restores dpy-10(wt) (grey) simultaneously with insertion of another gene fragment (light blue). Repeat rounds of co-CRISPR using the Dumpy and nonDumpy phenotypes allows iterative editing of the target locus and efficient sequential build up of a large gene assembly (additional blue boxes).
F. Assessing neurodegeneration C. elegans phasmid neurons take up fluorescent lipophilic dyes via exposed sensory endings. Sensory ending defects, process retraction or neuron loss can cause dye-filling defects.
G. Mild stress with 2.5mM paraquat for 22 hours does not cause dye filling defects in N2 (white), WT hTARDBP (HA3971, blue), or tdp-1(-) animals (lof, HA3703). Three independent trials; 20 animals per genotype per trial.
H. Moderate stress with 10mM paraquat for 22 hours causes dye filling defects in tdp-1(tgx58) loss of function animals (lof, HA3703, red) that exceed defects observed in N2 animals (white) or WT hTARDBP animals (HA3971, blue). Twelve independent trials; 20 animals per genotype per trial.
I. Patient variants inserted into hTARDBP Generation of patient variants M337V, A315T, G298S, and G294A did not result in moderate stress-induced dye filling defects, only G295S differed from hTARDBP. Three independent trials with 20 animals per genotype per trial; hash marks on X-axis group separate genotypes assayed simultaneously. Note that the experimental results shown in Panel G for N2, hTARDBP and tdp-1(-) are the same experimental results as shown in Panel F; results are consolidated in Panel F for ease of presentation. Strains used were HA4008 for M337V, HA4006 for A315T#1, HA4007 for A315T#2, HA4003 for G298S, HA4005 for G294A, HA3983 for G295S.
","imageTitle":"Humanizing tdp-1 to determine if patient variants cause stress-induced neurodegeneration
","laboratory":{"name":"HA","WBId":""},"methods":"Neurodegeneration: L4 stage animals were moved to NGM/OP50 plates containing 10mM (or 2.5mM) paraquat for 22 hours and neurodegeneration was examined the next day in adults based on backfilling of phasmids neurons with DiI (Molecular Probes). Animals were scored as affected if any of the four phasmid neurons failed to backfill with fluorescent dye, detected at a magnification level of 12.5x with moving animals on culture dishes; note that loss of a single neuron will be missed in some animals and we may underestimate neurodegeneration. Animals were scored blinded as to genotype.
Genome editing: The tdp-1(tgx58) KO allele was generated by deletion of the coding sequence using CRISPR/Cas9-mediated homologous recombination. The dpy-10 co-conversion strategy was used to identify candidate lines after injection (Arribere et al. 2014). Two guide RNAs (sgRNAs) were selected, one in the first tdp-1 coding exon and the other after the stop codon creating a 1787bp deletion. All sgRNAs were synthesized by Synthego Corporation (Redwood City, CA). The donor homology sequence was a single stranded oligonucleotide (ssODN) containing 35bp homology arms, a 3-frame stop sequence, and an XhoI restriction site (reagent table). Injections of the Cas9 protein, sgRNAs, and donor homology template mix were performed with N2 young adults. Genome edit candidates were selected from the F1 population based on a visual screen for the co-conversion Rol phenotype and screened by PCR for the deletion. Homozygous deletion lines were confirmed by sequencing.
The hTARDBP-WT insertion was generated using a gene swap method (McCormick et al. 2021) with modifications to use PCR products as the donor homology template through sequential rounds of editing. The first insertion used the dpy-10 co-conversion CRISPR/Cas9 strategy to insert 725bp of the hTARDBP sequence. The injection mix included Cas9 protein, the 795bp dsDNA donor homology template, sgRNAs, and co-CRISPR reagents. This was injected into the gonads of adult hermaphrodite worms and the F1 animals displaying the co-CRISPR phenotype were isolated. Homozygous animals containing the insertion were identified; however, they also contained the dpy-10(cn64) mutation. An edit to correct this mutation was performed and animals with wild type sequence at the dpy-10 locus, but containing the partial hTARDBP-WT were identified. This strain was injected with the 756bp PCR product donor homology template containing the second half of the hTARDBP sequence and homology arms, along with the Cas9 protein, sgRNAs, and the dpy-10 co-CRISPR reagents. Animals homozygous for the insertion as well as the dpy-10(cn64) mutation were isolated and the corrective edit for dpy-10 was performed. Integration of the complete sequence of hTARDBP was confirmed by Sanger sequence analysis. When complete, the hTARDBP-WT strain contained a codon optimized version (Redemann et al. 2011) of 414 amino acid hTARDBP with 3 synthetic introns. Note that hTARDBP was introduced into the native tdp-1 exon 1 such that the first 5 native C. elegans amino acids were preserved (i.e. MADET). Verification hTARDBP mRNA expression was undertaken. RNA was extracted from the hTARDBP-WT strain and N2 using TRI Reagent and the Direct-zol RNA kit (Zymo Research) and cDNA was synthesized using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories). To amplify the whole coding sequence, PCR was performed, see reagent table for primers, on the cDNA and visualized on an agarose gel. The full length hTARDBP sequence amplified from the humanized strain at a comparable level to tdp-1 in N2. The amplicons were also used as a template for DNA sequencing by Sequetech Corporation. Sequences were aligned and analyzed using Benchling and full-length hTARDBP was observed.
The hTARDBP variants were inserted using CRISPR/Cas9-mediated homologous recombination. For each variant, two sgRNAs flanking the desired edit were selected. The donor homology was designed with 35bp homology arms and re-coding to eliminate recutting of the repaired template and to make identification of the edits easier. The injection mixes included Cas9 protein, each donor homology single-stranded oligonucleotide (ssODN), the sgRNAs, and the dpy-10 co-CRISPR reagents. Animals displaying the co-CRISPR phenotype were selected and High Resolution Melt Analysis was performed to identify animals containing the edit of interest. Homozygous animals were isolated and confirmed by sequencing of both the target locus and the dpy-10 locus. Original, edited strains were backcrossed to N2 four times to create outcrossed strains, which were used to generate results presented herein.
Statistical analysis: Student’s t-test used for comparison of neurodegeneration (Microsoft Excel).
","reagents":"gene | outcrossed strain | origin strain | genotype | source |
This study | ||||
hTARDBP(wt) | This study | |||
hTARDBP(G295S) | tdp-1(tgx286tgx359 [humanTARDBP G295S]) II | This study | ||
hTARDBP(G298S) | tdp-1(tgx286tgx371 [humanTARDBP G298S]) II | This study | ||
hTARDBP(G294A) | tdp-1(tgx286tgx382 [humanTARDBP G294A]) II | This study | ||
hTARDBP(A315T) | tdp-1(tgx286tgx416 [humanTARDBP A315T]) II | This study | ||
hTARDBP(A315T) | tdp-1(tgx286tgx417 [humanTARDBP A315T]) II | This study | ||
hTARDBP(M337V) | tdp-1(tgx286tgx400 [humanTARDBP M337V]) II | This study |
reference | sgRNA 1 | sgRNA 2 | ssODN sequence or plasmid name |
tdp-1(-) | AATGGCCGACGAAACGCCGA | CGTCGACATGAAAATTGTAG | ATCTGTTTCCAGTCACTAAATGGCCGACGAAACGCTAAATAAATAAACTCGAGCAATTTTCATGTCGACGCACTTTGCGATTTTATGC |
hTARDBP(wt) part 1 | AATGGCCGACGAAACGCCGA | CCGGTCGATCACGTTCTCTG | tatctgtttccagTCACTAAATGGCCGACGAAACGATGTCCGAGTACATCCGTGTCACGGAGGATGAAAACGACGAGCCAATCGAGATCCCATCCGAGGACGACGGAACCGTCCTCCTCTCCACCGTCACCGCCCAATTCCCAGGAGCCTGCGGACTCCGTTACCGTAACCCAGTCTCCCAATGCATGCGTGGAGTCCGTCTCGTCGAGGGAATCCTCCACGCCCCAGACGCCGGATGGGGAAACCTCGTCTACGTCGTCAACTACCCAAAGGACAACAAGCGTAAGATGGACGAGACCGACGCCTCCTCCGCCGTCAAAGTCAAGCGTGCCGTCCAAAAGgtgagttattataatttttttgatcacaacgattattttaattttcagACCTCGGACCTCATAGTGCTCGGACTCCCATGGAAGACCACCGAGCAAGACCTCAAGGAGTACTTCTCCACCTTCGGAGAGGTCCTCATGGTCCAAGTCAAGAAGGACCTCAAGACCGGACACTCCAAGGGATTCGGATTCGTCCGTTTCACCGAGTACGAGACCCAAGTCAAGGTCATGTCCCAACGTCACATGATCGACGGACGTTGGTGCGACTGCAAGCTCCCAAACTCCAAGCAATCCCAAGACGAGCCACTCCGTTCCAGGAAGgttaaatgtacaaacaactatttgaaagattttctcacccgattttttcagGTCTTCGTCGGACGTTGCACCGAGGACATGACCGAGGACGAGCTCCGTGAAGAACGTGATCGACCGGATAGACGACCGATTCAAA |
hTARDBP(wt) part 2 | TTGCACCGAGGACATGACCG | GAGACTCGAGAGGACCAGGA | tcagGTCTTCGTCGGACGTTGCACCGAGGACATGACTGAAGATGAACTTAGAGAGTTCTTCTCCCAATACGGAGACGTCATGGACGTCTTCATCCCAAAGCCATTCCGTGCCTTCGCCTTCGTCACCTTCGCCGACGACCAAATCGCCCAATCCCTCTGCGGAGAGGACCTCATCATCAAGgtaaataattatacattcgatgataaatttatgcgtactatttttcagGGAATCTCCGTCCACATCTCCAACGCCGAGCCAAAGCACAACTCCAACCGTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCGGGGGGATTCGGAAACCAAGGAGGGTTCGGGAACTCCCGTGGAGGAGGAGCCGGACTCGGGAACAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCGGAGCCTTCTCCATCAACCCAGCCATGATGGCCGCCGCCCAAGCCGCCCTCCAATCCTCCTGGGGAATGATGGGAATGCTCGCCTCCCAACAAAACCAATCCGGACCATCCGGAAACAACCAAAATCAGGGGAACATGCAACGTGAGCCAAACCAAGCCTTCGGATCGGGGAACAACTCCTACTCCGGATCCAACTCCGGAGCCGCCATCGGATGGGGATCCGCCTCCAACGCGGGGTCCGGATCCGGGTTCAACGGAGGATTCGGATCCTCCATGGACTCCAAGTCCTCCGGATGGGGAATGTAAGGATGGTGATTCTCTCGAAAAATCGTTATTATTCA |
hTARDBP(G295S) | GACGTTTCGGAGGAAACCCG | GCCGGACTCGGGAACAACCA | GTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCAGGTGGTTTCGGTAACCAGGGTGGTTTTGGCAATTCAAGGGGATCTGGAGCAGGTCTTGGTAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(G298S) | GGAACGCTCGAGTTGACGGT | GCCGGACTCGGGAACAACCA | CATCTCCAACGCCGAGCCAAAGCACAACTCCAACAGACAGCTTGAACGCTCTGGAAGATTCGGTGGTAATCCGGGAGGTTTCGGTAATCAGGGTGGTTTCGGTAACTCTAGAGGCGGTGGAGCTTCTCTTGGAAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(G294A) | GACGTTTCGGAGGAAACCCG | GCCGGACTCGGGAACAACCA | GTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCAGGAGGTTTTGGTAATCAAGGTGGATTTGGAAATTCTAGAGCTGGTGGTGCTGGTTTAGGTAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(A315T) | GCCGGACTCGGGAACAACCA | TTGGAGGGCGGCTTGGGCGG | AACTCCCGTGGAGGAGGAGCCGGACTCGGGAACAACCAAGGCTCTAATATGGGCGGCGGCATGAATTTTGGAACCTTTTCTATTAATCCCGCTATGATGGCTGCTGCCCAAGCCGCCCTCCAATCCTCCTGGGGAATGATG |
hTARDBP(M337V) | TTGGAGGGCGGCTTGGGCGG | GCCAAACCAAGCCTTCGGAT | AGCCTTCTCCATCAACCCAGCCATGATGGCCGCCGCTCAGGCTGCTCTTCAATCTTCTTGGGGTATGGTTGGTATGCTTGCTTCTCAACAGAACCAGTCTGGTCCGTCTGGTAATAACCAGAACCAAGGGAATATGCAGCGCGAACCAAATCAGGCTTTTGGATCGGGGAACAACTCCTACTCCGGATCCAACTCC |
dpy-10(wt) | CTCGTGGTGCCTATGGTAGC | CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCTCGTGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT |
Primer name | Primer Sequence |
hTARDBP FWD (86) | GGAAACCTCGTCTACGTCGTCA |
hTARDBP REV (88) | ATCCGAATCCTCCGTTGAACCC |
tdp-1 FWD (87) | CCGACGAAACGCCGAAGG |
tdp-1 REV (89) | GTCTCCAGGTGCCCAGTATCTC |
reagent | source |
1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate (DiI) | Molecular Probes |
XhoI (cat#R0146L) | New England Biochemicals |
Cas9 protein with NLS, high concentration (cat#CP02) | PNA Bio |
TRI Reagent (cat#R2050-1-200) | Zymo Research |
Direct-zol RNA Miniprep (cat#R2052) | Zymo Research |
iScript™ Reverse Transcription Supermix for RT-qPCR (cat#1708840) | Bio-Rad Laboratories |
Patient variants in TARDBP, which encodes the RNA-binding protein TDP-43, are associated with a wide variety of degenerative disorders. These include frontotemporal dementia (FTD) which leads to degeneration and death of cortical neurons, as well as amyotrophic lateral sclerosis (ALS), which leads to degeneration and death of spinal and cortical motor neurons. The C. elegans ortholog of TARDBP is TAR DNA-binding Protein homolog-1, known as tdp-1. To enable studies of TDP-1 function, and to demonstrate functional homology between TDP-1 and TARDBP, as well as to examine how patient-associated missense variants alter protein function in live animals, we undertook several rounds of CRISPR/Cas9-based genome deletion, humanization, and variant generation (Panels A, B and C), with a focus on generating reagents and assessing neurodegeneration.
Knock out. First, we created a tdp-1 loss of function allele by precise excision using CRISPR-editing. Using CRISPR/Cas9-mediated homologous recombination and dpy-10 co-conversion (Arribere et al. 2014), we designed a knockout (KO) that would remove all tdp-1 coding exons, as well as introns (Panel B) resulting in an unequivocal complete loss of function allele. When generating tdp-1 KOs, we observed robust co-conversion of the dpy-10 and tdp-1 loci on the same maternal chromosome (Panel D), as expected from previous work (Medley et al. 2022). However we also observed biallelic conversion of the sister chromosome, as seen previously (Kim et al. 2014), which allowed us to isolate the tdp-1(tgx58) deletion as homozygote, free of the Dumpy phenotype marker.
Assess neurodegeneration for tdp-1(lof). To determine if loss of tdp-1 function in C. elegans leads to degeneration and/or loss of neurons, we examined stress-induced degeneration of glutamatergic sensory neurons. PHA and PHB neurons are bilaterally-symmetric phasmid neurons in the C. elegans tail that have exposed sensory endings (Panel F). Degenerative retraction of phasmid neuron sensory processes or phasmid neuron death can prevent fluorescent dye back-filling of the entire neuron. This assay has been used previously in C. elegans models of neurodegenerative disease (Faber et al. 1999; Baskoylu et al. 2018; Ryan et al. 2020). Hypersensitivity to stress can reveal latent defects in C. elegans models of neurodegenerative disease (Baskoylu et al. 2018; Nass et al. 2002). Noting reports that perturbation of tdp-1 function causes hypersensitivity to oxidative stress (Vaccaro, Tauffenberger, Ash, et al. 2012), we compared wild type animals to tdp-1(tgx58) animals at two concentrations of paraquat. Mild paraquat stress overnight had no impact on neurodegeneration in the dye filling assay in either wild type or tdp-1(tgx58) young adult animals (Panel G, 22 hours, 2.5mM paraquat). However, 10mM paraquat-treatment overnight led to modest dye filling defects in wild type with more dramatic defects in tdp-1(tgx58) animals (Panel H, 22 hours, 10mM paraquat). These results confirm that tdp-1 loss of function increases neurodegeneration under moderate oxidative stress.
Humanize and insert clinical variants. With a KO phenotype established, we used two serial rounds of co-CRISPR editing (Arribere et al. 2014) to insert sequences encoding human TARDBP as a replacement of the tdp-1 coding sequence (Panel C). For this humanized construct, we focused on expressing the most abundant isoform of TARDBP (UNIPROT Q13148-1) re-coded for C. elegans codon bias and with the insertion of three synthetic introns. A full length plasmid containing a synthetic TARDBP sequence could not be generated by our suppliers. As an alternative, we elected to consecutively insert two fragments of TARDBP using co-CRISPR-editing. Insertion of the first fragment of recoded TARDBP resulted only in cis co-editing events (target edit occurring on same strand as selection marker, Panel D); all animals homozygous for the intended tdp-1 edit were also Dumpy (homozygous for dpy-10(cn64)). To move hTARDBP to a wild type background, we undertook an additional round of CRISPR-editing to restore the original N2 wild type dpy-10 sequence (dpy-10(wt)). Another round of co-CRISPR to insert the second fragment of recoded TARDBP also resulted in only cis co-editing and all animals homozygous for full length TARDBP were also Dumpy. Again, a round of repair CRISPR was used to restore the dpy-10 locus back to nonDumpy (original N2 sequence, wild type phenotype).
The observation of cis-only editing with the co-generation of dpy-10 alleles, followed by a need to repair to get back to wildtype phenotype, leads us to suggest that future studies should use a serial-editing strategy to build up a large gene with a “flip-flop approach” that alternates between Dumpy and nonDumpy animals (Panel E).
Expression of full length hTARDBP was confirmed by rtPCR and the LOF defect of tdp-1(-) was partially rescued in the hTARDBP animals. (Panel H). We used co-CRISPR editing to insert each of the five ALS/FTD clinical variants into the humanized locus (G294A, G295S, G298S, A315T, and M337V). Over-expression of TARDBP A315T is toxic in two different C. elegans models and TARDBP M337V is toxic in two different C. elegans models (Vaccaro, Tauffenberger, Aggad, et al. 2012; Liachko, Guthrie, and Kraemer 2010; Zhang et al. 2012). C. elegans models for the other alleles have not been reported previously.
Assess neurodegeneration for clinical variants. Only insertion of hTARDBP-G295S yielded a significant defect versus hTARDBP-WT (Panel I). Future work will likely require confirmation of the G295S defect with the generation and testing of another independently-derived allele. For the remaining alleles (G294A, G298S, A315T, and M337V), no significant increases in stress-induced neurodegeneration were observed, compared to hTARDBP-WT, using this assay.
","references":[{"reference":"Arribere JA, Bell RT, Fu BX, Artiles KL, Hartman PS, Fire AZ. 2014. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics 198: 837-46.
","pubmedId":"25161212","doi":""},{"reference":"Baskoylu SN, Yersak J, O'Hern P, Grosser S, Simon J, Kim S, et al., Hart AC. 2018. Single copy/knock-in models of ALS SOD1 in C. elegans suggest loss and gain of function have different contributions to cholinergic and glutamatergic neurodegeneration. PLoS Genet 14: e1007682.
","pubmedId":"30296255","doi":""},{"reference":"Faber PW, Alter JR, MacDonald ME, Hart AC. 1999. Polyglutamine-mediated dysfunction and apoptotic death of a Caenorhabditis elegans sensory neuron. Proc Natl Acad Sci U S A 96: 179-84.
","pubmedId":"9874792","doi":""},{"reference":"Kim H, Ishidate T, Ghanta KS, Seth M, Conte D Jr, Shirayama M, Mello CC. 2014. A co-CRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197: 1069-80.
","pubmedId":"24879462","doi":""},{"reference":"Liachko NF, Guthrie CR, Kraemer BC. 2010. Phosphorylation promotes neurotoxicity in a Caenorhabditis elegans model of TDP-43 proteinopathy. J Neurosci 30: 16208-19.
","pubmedId":"21123567","doi":""},{"reference":"McCormick, Kathryn, Trisha Brock, Matthew Wood, Lan Guo, Kolt McBride, Christine Kim, Lauren Resch, et al. 2021. “A Gene Replacement Humanization Platform for Rapid Functional Testing of Clinical Variants in Epilepsy-Associated STXBP1.” bioRxiv. https://doi.org/10.1101/2021.08.13.453827.
Medley JC, Hebbar S, Sydzyik JT, Zinovyeva AY. 2022. Single nucleotide substitutions effectively block Cas9 and allow for scarless genome editing in Caenorhabditis elegans. Genetics 220: .
","pubmedId":"34791245","doi":""},{"reference":"Nass R, Hall DH, Miller DM 3rd, Blakely RD. 2002. Neurotoxin-induced degeneration of dopamine neurons in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99: 3264-9.
","pubmedId":"11867711","doi":""},{"reference":"Redemann S, Schloissnig S, Ernst S, Pozniakowsky A, Ayloo S, Hyman AA, Bringmann H. 2011. Codon adaptation-based control of protein expression in C. elegans. Nat Methods 8: 250-2.
","pubmedId":"21278743","doi":""},{"reference":"Ryan VH, Perdikari TM, Naik MT, Saueressig CF, Lins J, Dignon GL, et al., Fawzi NL. 2021. Tyrosine phosphorylation regulates hnRNPA2 granule protein partitioning and reduces neurodegeneration. EMBO J 40: e105001.
","pubmedId":"33349959","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Aggad D, Rouleau G, Drapeau P, Parker JA. 2012. Mutant TDP-43 and FUS cause age-dependent paralysis and neurodegeneration in C. elegans. PLoS One 7: e31321.
","pubmedId":"22363618","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Aggad D, Rouleau G, Drapeau P, Parker JA. 2012. Mutant TDP-43 and FUS cause age-dependent paralysis and neurodegeneration in C. elegans. PLoS One 7: e31321.
","pubmedId":"22363618","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Ash PE, Carlomagno Y, Petrucelli L, Parker JA. 2012. TDP-1/TDP-43 regulates stress signaling and age-dependent proteotoxicity in Caenorhabditis elegans. PLoS Genet 8: e1002806.
","pubmedId":"22792076","doi":""},{"reference":"Zhang T, Hwang HY, Hao H, Talbot C Jr, Wang J. 2012. Caenorhabditis elegans RNA-processing protein TDP-1 regulates protein homeostasis and life span. J Biol Chem 287: 8371-82.
","pubmedId":"22232551","doi":""}],"suggestedReviewer":{"name":"Todd Lamitina, Aimee Kao, Brian Kraemer, John Pierce, Alex Parker","WBId":""},"title":"Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants.
","reviews":[]},{"id":"ee617a82-dbee-4284-b4d9-fb65743bc33a","decisionLetter":"\n\n Dear Authors,\n
\n\n Congratulations on your new publication! We are pleased to let you know that your microPublication is \n now available online. You can access it here: https://micropublication.org/journals/biology/micropub-biology-000693\n
\n\n Your article will be sent to PubMed Central in 2 weeks. Please make sure there are no typos, errors or \n omissions in your article, including your title, author names, affiliations, reagents, etc. in addition \n to your reported results. If you want to make corrections, contact us with the title of your article and \n your requested edits at editors@micropublication.org.\n
\n\n After two weeks, any correction will require a separate corrigendum article at the editor's discretion.\n
\n\n Thank you for submitting your data to us. We look forward to working with you again.\n
\n\n For your records, this is your article's citation:
\n \"Lins, J; Brock, TJ; Hopkins, CE; Hart, AC (2023). Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants.. microPublication Biology. 10.17912/micropub.biology.000693.\"\n
\n Best wishes,\n
\n\n The microPublication Team\n
\n ","decision":"publish","submitted":true,"abstract":"Clinical variants of TARDBP are associated with frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS) and other degenerative diseases. The predicted C. elegans ortholog of TARDBP is encoded by tdp-1, but functional orthology has not been demonstrated in vivo. We undertook CRISPR/Cas9-based genome editing of the tdp-1 locus to create a complete loss of function allele; all tdp-1 exons and introns were deleted, creating tdp-1(tgx58), which resulted in neurodegeneration after oxidative stress. Next, we undertook CRISPR-based genome editing to replace tdp-1 exons with human TARDBP coding sequences, creating humanized (hTARDBP) C. elegans expressing TDP-43. Based on the efficiency of this genome editing, we suggest that iterative genome editing of the tdp-1 target locus using linked coCRISPR markers, like dpy-10, would be a more efficient strategy for sequential assembly of the large engineered transgenes. hTARDBP decreased the neurodegeneration defect of tdp-1(tgx58), demonstrating functional cross-species orthology. To develop C. elegans models of FTD and ALS, we inserted five different patient TARDBP variants in the C. elegans hTARDBP locus. Only one clinical variant increased stress-induced neurodegeneration; other variants caused inconsistent or negligible defects under these conditions. Combined, this work yielded an unambiguous null allele for tdp-1, a validated, humanized hTARDBP, and multiple ALS/FTD patient-associated variant models that can be used for future studies.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).","authors":[{"affiliations":["Department of Neuroscience, Brown University, Providence, RI 02912"],"credit":["writing_reviewEditing","investigation"],"email":"jeremy_lins@brown.edu","firstName":"Jeremy","lastName":"Lins","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":null},{"affiliations":["InVivo Biosystems, Eugene, OR, 79402"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","writing_originalDraft","writing_reviewEditing"],"email":"trisha.brock@invivobiosystems.com","firstName":"Trisha J","lastName":"Brock","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":"0000-0003-4540-0123"},{"affiliations":["InVivo Biosystems, Eugene, OR, 79402"],"credit":["conceptualization","fundingAcquisition","methodology","project","supervision","writing_originalDraft","writing_reviewEditing"],"email":"chris.hopkins@invivobiosystems.com","firstName":"Chris E","lastName":"Hopkins","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":"","orcid":"0000-0003-4540-0123"},{"affiliations":["Department of Neuroscience, Brown University, Providence, RI 02912"],"credit":["conceptualization","fundingAcquisition","methodology","project","supervision","writing_originalDraft","writing_reviewEditing"],"email":"anne_hart@brown.edu","firstName":"Anne C","lastName":"Hart","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7239-4350"}],"comments":"We appreciate the thoughtful comments and careful reading of the manuscript by the reviewers and curators. All corrections suggested have been incorporated into the revised manuscript.
Reviewer: Minor points to address/correct.
Frontotemporal Dementia and Amyotrophic Lateral Sclerosis should not be capitalized (the abbreviations are fine, of course).
Corrected
Sentence “For the remaining alleles (G294A, G298S, A315T, and M337V) no increases from hTARDBP-WT were observed using this stress-induced neurodegeneration assay.” Should be re-written, is a little awkward - no increased neurodegeneration compared to WT, or the remaining alleles were not significantly different that WT, etc.
Rephrased as “For the remaining alleles (G294A, G298S, A315T, and M337V), no significant increases in stress-induced neurodegeneration were observed, compared to hTARDBP-WT, using this assay.”
Any speculation on why only one variant showed neurodegeneration?
We do not wish to speculate why one allele shows a significant defect and the other alleles don’t.
~~~~~~~~~~~~
Curator's comments:
1. Authors should indicate in the experimental details what elegans strain they used in addition or in conjunction (next to) names such as \"hTARDBP\" and \"hTARDBP M337V\"; authors can indicate this in the Fig. 1 text/explanation if it is hard to put it on the figure itself. These kinds of practices increases curation efficiency as curators then don't have to go back and forth to see what strain name maps to what variant/genotype.
Strain designations were added to the figure legend to assist with curation. Example: “Strains used were HA4008 for M337V, HA4006 for A315T#1, HA4007 for A315T#2, HA4003 for G298S, HA4005 for G294A, HA3983 for G295S.”
2. I'm assuming that the column labeled \"outcrossed strain\" is what they used in experiments; but would be clearer if authors said this as well somewhere.
Clarified in the methods with the statement “Original, edited strains were backcrossed to N2 four times to create outcrossed strains, which were used to generate results presented herein.”
3. Authors should remove all in-text citation links to their references
Done
4. should nmx58 by tgx58 in \"Genome editing: The tdp-1(nmx58) KO allele was...\"?
Corrected.
5. Should \"We used co-CRISPR editing to insert the five ALS/FTD clinical variants...\" be \"We used co-CRISPR editing to insert each of the five ALS/FTD clinical variants...\" otherwise it sounds like all five variants were inserted into one line.
Corrected.
A. Strategy for genome editing. A wild type (N2, white) animal is CRISPR-edited to make a knock-out (KO, red) animal. When loss-of-function defects are detected in the KO, the gene is humanized (blue); wild type C. elegans exons and introns are excised and replaced with human coding sequences. Finally, another round of CRISPR-editing is undertaken to insert clinical variants (grey) into the humanized locus. Comparison of the N2 and KO permits detection of loss of function defects. Comparison of these with the humanized-control reveals functional orthology by rescue, and comparison to patient-associated allele lines allows detection of variant defects.
B. Knock out of tdp-1 locus. Creation of a tdp-1 KO null allele by CRISPR-editing required deleting sequences (red) containing exons and introns (grey boxes and intervening lines).
C. Human gene replacement at tdp-1 locus. CRISPR-editing was used to remove endogenous coding sequences and insert human gene coding sequences to create hTADRBP, containing artificial introns (blue exon boxes linked by orange artificial intron line).
D. Cis editing predominates. A CRISPR-editing approach was used to insert hTARDBP sequences into the tdp-1 locus (black), which is closely linked to the dpy-10 locus (grey). These loci are ~2 centiMorgans apart. At the co-CRISPR marker dpy-10 locus, one allele was converted to dpy-10(cn64) and the other allele was unedited (hemi-converted); the resulting Roller heterozygotes were selected (green). Co-conversion of the tdp-1 target locus with hTARDBP fragment insertion occurred only on the cis strand (blue).
E. Iterative assembly using linked alleles. Target genes that are tightly linked to a coCRISPR marker can be iteratively co-CRISPR-edited to build large transgenes by flip-flop selection procedure. In this example, the dpy-10 locus is co-CRISPR converted to yield dpy-10(cn64) (green) and conversion of the linked locus to contain a gene fragment content (dark blue) in the first step. In the second step, using the Dumpy animals from the first step, a repeat round of co-CRISPR restores dpy-10(wt) (grey) simultaneously with insertion of another gene fragment (light blue). Repeat rounds of co-CRISPR using the Dumpy and nonDumpy phenotypes allows iterative editing of the target locus and efficient sequential build up of a large gene assembly (additional blue boxes).
F. Assessing neurodegeneration C. elegans phasmid neurons take up fluorescent lipophilic dyes via exposed sensory endings. Sensory ending defects, process retraction or neuron loss can cause dye-filling defects.
G. Mild stress with 2.5mM paraquat for 22 hours does not cause dye filling defects in N2 (white), WT hTARDBP (HA3971, blue), or tdp-1(-) animals (lof, HA3703). Three independent trials; 20 animals per genotype per trial.
H. Moderate stress with 10mM paraquat for 22 hours causes dye filling defects in tdp-1(tgx58) loss of function animals (lof, HA3703, red) that exceed defects observed in N2 animals (white) or WT hTARDBP animals (HA3971, blue). Twelve independent trials; 20 animals per genotype per trial. By student’s T-test, p value for tdp-1(lf) vs N2 is 0.001 and vs hTARDBP is 0.056, while hTARDBP vs N2 is likely not significant at 0.11.
I. Patient variants inserted into hTARDBP Generation of patient variants M337V, A315T, G298S, and G294A did not result in moderate stress-induced dye filling defects, only G295S differed from hTARDBP. Three independent trials with 20 animals per genotype per trial; hash marks on X-axis group separate genotypes assayed simultaneously. Note that the experimental results shown in Panel G for N2, hTARDBP and tdp-1(-) are the same experimental results as shown in Panel F; results are consolidated in Panel F for ease of presentation. Strains used were HA4008 for M337V, HA4006 for A315T#1, HA4007 for A315T#2, HA4003 for G298S, HA4005 for G294A, HA3983 for G295S. By student’s T-test, p value for WT versus G298S is <0.05.
","imageTitle":"Humanizing tdp-1 to determine if patient variants cause stress-induced neurodegeneration
","laboratory":{"name":"HA","WBId":""},"methods":"Neurodegeneration: L4 stage animals were moved to NGM/OP50 plates containing 10mM (or 2.5mM) paraquat for 22 hours and neurodegeneration was examined the next day in adults based on backfilling of phasmids neurons with DiI (Molecular Probes). Animals were scored as affected if any of the four phasmid neurons failed to backfill with fluorescent dye, detected at a magnification level of 12.5x with moving animals on culture dishes; note that loss of a single neuron will be missed in some animals and we may underestimate neurodegeneration. Animals were scored blinded as to genotype.
Genome editing: The tdp-1(tgx58) KO allele was generated by deletion of the coding sequence using CRISPR/Cas9-mediated homologous recombination. The dpy-10 co-conversion strategy was used to identify candidate lines after injection (Arribere et al. 2014). Two guide RNAs (sgRNAs) were selected, one in the first tdp-1 coding exon and the other after the stop codon creating a 1787bp deletion. All sgRNAs were synthesized by Synthego Corporation (Redwood City, CA). The donor homology sequence was a single stranded oligonucleotide (ssODN) containing 35bp homology arms, a 3-frame stop sequence, and an XhoI restriction site (reagent table). Injections of the Cas9 protein, sgRNAs, and donor homology template mix were performed with N2 young adults. Genome edit candidates were selected from the F1 population based on a visual screen for the co-conversion Rol phenotype and screened by PCR for the deletion. Homozygous deletion lines were confirmed by sequencing.
The hTARDBP-WT insertion was generated using a gene swap method (McCormick et al. 2021) with modifications to use PCR products as the donor homology template through sequential rounds of editing. The first insertion used the dpy-10 co-conversion CRISPR/Cas9 strategy to insert 725bp of the hTARDBP sequence. The injection mix included Cas9 protein, the 795bp dsDNA donor homology template, sgRNAs, and co-CRISPR reagents. This was injected into the gonads of adult hermaphrodite worms and the F1 animals displaying the co-CRISPR phenotype were isolated. Homozygous animals containing the insertion were identified; however, they also contained the dpy-10(cn64) mutation. An edit to correct this mutation was performed and animals with wild type sequence at the dpy-10 locus, but containing the partial hTARDBP-WT were identified. This strain was injected with the 756bp PCR product donor homology template containing the second half of the hTARDBP sequence and homology arms, along with the Cas9 protein, sgRNAs, and the dpy-10 co-CRISPR reagents. Animals homozygous for the insertion as well as the dpy-10(cn64) mutation were isolated and the corrective edit for dpy-10 was performed. Integration of the complete sequence of hTARDBP was confirmed by Sanger sequence analysis. When complete, the hTARDBP-WT strain contained a codon optimized version (Redemann et al. 2011) of 414 amino acid hTARDBP with 3 synthetic introns. Note that hTARDBP was introduced into the native tdp-1 exon 1 such that the first 5 native C. elegans amino acids were preserved (i.e. MADET). Verification hTARDBP mRNA expression was undertaken. RNA was extracted from the hTARDBP-WT strain and N2 using TRI Reagent and the Direct-zol RNA kit (Zymo Research) and cDNA was synthesized using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories). To amplify the whole coding sequence, PCR was performed, see reagent table for primers, on the cDNA and visualized on an agarose gel. The full length hTARDBP sequence amplified from the humanized strain at a comparable level to tdp-1 in N2. The amplicons were also used as a template for DNA sequencing by Sequetech Corporation. Sequences were aligned and analyzed using Benchling and full-length hTARDBP was observed.
The hTARDBP variants were inserted using CRISPR/Cas9-mediated homologous recombination. For each variant, two sgRNAs flanking the desired edit were selected. The donor homology was designed with 35bp homology arms and re-coding to eliminate recutting of the repaired template and to make identification of the edits easier. The injection mixes included Cas9 protein, each donor homology single-stranded oligonucleotide (ssODN), the sgRNAs, and the dpy-10 co-CRISPR reagents. Animals displaying the co-CRISPR phenotype were selected and High Resolution Melt Analysis was performed to identify animals containing the edit of interest. Homozygous animals were isolated and confirmed by sequencing of both the target locus and the dpy-10 locus. Original, edited strains were backcrossed to N2 four times to create outcrossed strains, which were used to generate results presented herein.
Statistical analysis: Student’s t-test used for comparison of neurodegeneration (Microsoft Excel).
","reagents":"gene | outcrossed strain | origin strain | genotype | source |
This study | ||||
hTARDBP(wt) | This study | |||
hTARDBP(G295S) | tdp-1(tgx286tgx359 [humanTARDBP G295S]) II | This study | ||
hTARDBP(G298S) | tdp-1(tgx286tgx371 [humanTARDBP G298S]) II | This study | ||
hTARDBP(G294A) | tdp-1(tgx286tgx382 [humanTARDBP G294A]) II | This study | ||
hTARDBP(A315T) | tdp-1(tgx286tgx416 [humanTARDBP A315T]) II | This study | ||
hTARDBP(A315T) | tdp-1(tgx286tgx417 [humanTARDBP A315T]) II | This study | ||
hTARDBP(M337V) | tdp-1(tgx286tgx400 [humanTARDBP M337V]) II | This study |
reference | sgRNA 1 | sgRNA 2 | ssODN sequence or plasmid name |
tdp-1(-) | AATGGCCGACGAAACGCCGA | CGTCGACATGAAAATTGTAG | ATCTGTTTCCAGTCACTAAATGGCCGACGAAACGCTAAATAAATAAACTCGAGCAATTTTCATGTCGACGCACTTTGCGATTTTATGC |
hTARDBP(wt) part 1 | AATGGCCGACGAAACGCCGA | CCGGTCGATCACGTTCTCTG | tatctgtttccagTCACTAAATGGCCGACGAAACGATGTCCGAGTACATCCGTGTCACGGAGGATGAAAACGACGAGCCAATCGAGATCCCATCCGAGGACGACGGAACCGTCCTCCTCTCCACCGTCACCGCCCAATTCCCAGGAGCCTGCGGACTCCGTTACCGTAACCCAGTCTCCCAATGCATGCGTGGAGTCCGTCTCGTCGAGGGAATCCTCCACGCCCCAGACGCCGGATGGGGAAACCTCGTCTACGTCGTCAACTACCCAAAGGACAACAAGCGTAAGATGGACGAGACCGACGCCTCCTCCGCCGTCAAAGTCAAGCGTGCCGTCCAAAAGgtgagttattataatttttttgatcacaacgattattttaattttcagACCTCGGACCTCATAGTGCTCGGACTCCCATGGAAGACCACCGAGCAAGACCTCAAGGAGTACTTCTCCACCTTCGGAGAGGTCCTCATGGTCCAAGTCAAGAAGGACCTCAAGACCGGACACTCCAAGGGATTCGGATTCGTCCGTTTCACCGAGTACGAGACCCAAGTCAAGGTCATGTCCCAACGTCACATGATCGACGGACGTTGGTGCGACTGCAAGCTCCCAAACTCCAAGCAATCCCAAGACGAGCCACTCCGTTCCAGGAAGgttaaatgtacaaacaactatttgaaagattttctcacccgattttttcagGTCTTCGTCGGACGTTGCACCGAGGACATGACCGAGGACGAGCTCCGTGAAGAACGTGATCGACCGGATAGACGACCGATTCAAA |
hTARDBP(wt) part 2 | TTGCACCGAGGACATGACCG | GAGACTCGAGAGGACCAGGA | tcagGTCTTCGTCGGACGTTGCACCGAGGACATGACTGAAGATGAACTTAGAGAGTTCTTCTCCCAATACGGAGACGTCATGGACGTCTTCATCCCAAAGCCATTCCGTGCCTTCGCCTTCGTCACCTTCGCCGACGACCAAATCGCCCAATCCCTCTGCGGAGAGGACCTCATCATCAAGgtaaataattatacattcgatgataaatttatgcgtactatttttcagGGAATCTCCGTCCACATCTCCAACGCCGAGCCAAAGCACAACTCCAACCGTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCGGGGGGATTCGGAAACCAAGGAGGGTTCGGGAACTCCCGTGGAGGAGGAGCCGGACTCGGGAACAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCGGAGCCTTCTCCATCAACCCAGCCATGATGGCCGCCGCCCAAGCCGCCCTCCAATCCTCCTGGGGAATGATGGGAATGCTCGCCTCCCAACAAAACCAATCCGGACCATCCGGAAACAACCAAAATCAGGGGAACATGCAACGTGAGCCAAACCAAGCCTTCGGATCGGGGAACAACTCCTACTCCGGATCCAACTCCGGAGCCGCCATCGGATGGGGATCCGCCTCCAACGCGGGGTCCGGATCCGGGTTCAACGGAGGATTCGGATCCTCCATGGACTCCAAGTCCTCCGGATGGGGAATGTAAGGATGGTGATTCTCTCGAAAAATCGTTATTATTCA |
hTARDBP(G295S) | GACGTTTCGGAGGAAACCCG | GCCGGACTCGGGAACAACCA | GTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCAGGTGGTTTCGGTAACCAGGGTGGTTTTGGCAATTCAAGGGGATCTGGAGCAGGTCTTGGTAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(G298S) | GGAACGCTCGAGTTGACGGT | GCCGGACTCGGGAACAACCA | CATCTCCAACGCCGAGCCAAAGCACAACTCCAACAGACAGCTTGAACGCTCTGGAAGATTCGGTGGTAATCCGGGAGGTTTCGGTAATCAGGGTGGTTTCGGTAACTCTAGAGGCGGTGGAGCTTCTCTTGGAAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(G294A) | GACGTTTCGGAGGAAACCCG | GCCGGACTCGGGAACAACCA | GTCAACTCGAGCGTTCCGGACGTTTCGGAGGAAACCCAGGAGGTTTTGGTAATCAAGGTGGATTTGGAAATTCTAGAGCTGGTGGTGCTGGTTTAGGTAATAACCAGGGATCCAACATGGGAGGAGGAATGAACTTCG |
hTARDBP(A315T) | GCCGGACTCGGGAACAACCA | TTGGAGGGCGGCTTGGGCGG | AACTCCCGTGGAGGAGGAGCCGGACTCGGGAACAACCAAGGCTCTAATATGGGCGGCGGCATGAATTTTGGAACCTTTTCTATTAATCCCGCTATGATGGCTGCTGCCCAAGCCGCCCTCCAATCCTCCTGGGGAATGATG |
hTARDBP(M337V) | TTGGAGGGCGGCTTGGGCGG | GCCAAACCAAGCCTTCGGAT | AGCCTTCTCCATCAACCCAGCCATGATGGCCGCCGCTCAGGCTGCTCTTCAATCTTCTTGGGGTATGGTTGGTATGCTTGCTTCTCAACAGAACCAGTCTGGTCCGTCTGGTAATAACCAGAACCAAGGGAATATGCAGCGCGAACCAAATCAGGCTTTTGGATCGGGGAACAACTCCTACTCCGGATCCAACTCC |
dpy-10(wt) | CTCGTGGTGCCTATGGTAGC | CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCTCGTGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT |
Primer name | Primer Sequence |
hTARDBP FWD (86) | GGAAACCTCGTCTACGTCGTCA |
hTARDBP REV (88) | ATCCGAATCCTCCGTTGAACCC |
tdp-1 FWD (87) | CCGACGAAACGCCGAAGG |
tdp-1 REV (89) | GTCTCCAGGTGCCCAGTATCTC |
reagent | source |
1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate (DiI) | Molecular Probes |
XhoI (cat#R0146L) | New England Biochemicals |
Cas9 protein with NLS, high concentration (cat#CP02) | PNA Bio |
TRI Reagent (cat#R2050-1-200) | Zymo Research |
Direct-zol RNA Miniprep (cat#R2052) | Zymo Research |
iScript™ Reverse Transcription Supermix for RT-qPCR (cat#1708840) | Bio-Rad Laboratories |
Patient variants in TARDBP, which encodes the RNA-binding protein TDP-43, are associated with a wide variety of degenerative disorders. These include frontotemporal dementia (FTD) which leads to degeneration and death of cortical neurons, as well as amyotrophic lateral sclerosis (ALS), which leads to degeneration and death of spinal and cortical motor neurons. The C. elegans ortholog of TARDBP is TAR DNA-binding Protein homolog-1, known as tdp-1. To enable studies of TDP-1 function, and to demonstrate functional homology between TDP-1 and TARDBP, as well as to examine how patient-associated missense variants alter protein function in live animals, we undertook several rounds of CRISPR/Cas9-based genome deletion, humanization, and variant generation (Panels A, B and C), with a focus on generating reagents and assessing neurodegeneration.
Knock out. First, we created a tdp-1 loss of function allele by precise excision using CRISPR-editing. Using CRISPR/Cas9-mediated homologous recombination and dpy-10 co-conversion (Arribere et al. 2014), we designed a knockout (KO) that would remove all tdp-1 coding exons, as well as introns (Panel B) resulting in an unequivocal complete loss of function allele. When generating tdp-1 KOs, we observed robust co-conversion of the dpy-10 and tdp-1 loci on the same maternal chromosome (Panel D), as expected from previous work (Medley et al. 2022). However we also observed biallelic conversion of the sister chromosome, as seen previously (Kim et al. 2014), which allowed us to isolate the tdp-1(tgx58) deletion as homozygote, free of the Dumpy phenotype marker.
Assess neurodegeneration for tdp-1(lof). To determine if loss of tdp-1 function in C. elegans leads to degeneration and/or loss of neurons, we examined stress-induced degeneration of glutamatergic sensory neurons. PHA and PHB neurons are bilaterally-symmetric phasmid neurons in the C. elegans tail that have exposed sensory endings (Panel F). Degenerative retraction of phasmid neuron sensory processes or phasmid neuron death can prevent fluorescent dye back-filling of the entire neuron. This assay has been used previously in C. elegans models of neurodegenerative disease (Faber et al. 1999; Baskoylu et al. 2018; Ryan et al. 2020). Hypersensitivity to stress can reveal latent defects in C. elegans models of neurodegenerative disease (Baskoylu et al. 2018; Nass et al. 2002). Noting reports that perturbation of tdp-1 function causes hypersensitivity to oxidative stress (Vaccaro, Tauffenberger, Ash, et al. 2012), we compared wild type animals to tdp-1(tgx58) animals at two concentrations of paraquat. Mild paraquat stress overnight had no impact on neurodegeneration in the dye filling assay in either wild type or tdp-1(tgx58) young adult animals (Panel G, 22 hours, 2.5mM paraquat). However, 10mM paraquat-treatment overnight led to modest dye filling defects in wild type with more dramatic defects in tdp-1(tgx58) animals (Panel H, 22 hours, 10mM paraquat). These results confirm that tdp-1 loss of function increases neurodegeneration under moderate oxidative stress.
Humanize and insert clinical variants. With a KO phenotype established, we used two serial rounds of co-CRISPR editing (Arribere et al. 2014) to insert sequences encoding human TARDBP as a replacement of the tdp-1 coding sequence (Panel C). For this humanized construct, we focused on expressing the most abundant isoform of TARDBP (UNIPROT Q13148-1) re-coded for C. elegans codon bias and with the insertion of three synthetic introns. A full length plasmid containing a synthetic TARDBP sequence could not be generated by our suppliers. As an alternative, we elected to consecutively insert two fragments of TARDBP using co-CRISPR-editing. Insertion of the first fragment of recoded TARDBP resulted only in cis co-editing events (target edit occurring on same strand as selection marker, Panel D); all animals homozygous for the intended tdp-1 edit were also Dumpy (homozygous for dpy-10(cn64)). To move hTARDBP to a wild type background, we undertook an additional round of CRISPR-editing to restore the original N2 wild type dpy-10 sequence (dpy-10(wt)). Another round of co-CRISPR to insert the second fragment of recoded TARDBP also resulted in only cis co-editing and all animals homozygous for full length TARDBP were also Dumpy. Again, a round of repair CRISPR was used to restore the dpy-10 locus back to nonDumpy (original N2 sequence, wild type phenotype).
The observation of cis-only editing with the co-generation of dpy-10 alleles, followed by a need to repair to get back to wildtype phenotype, leads us to suggest that future studies should use a serial-editing strategy to build up a large gene with a “flip-flop approach” that alternates between Dumpy and nonDumpy animals (Panel E).
Expression of full length hTARDBP was confirmed by rtPCR and the LOF defect of tdp-1(-) was partially rescued in the hTARDBP animals. (Panel H). We used co-CRISPR editing to insert each of the five ALS/FTD clinical variants into the humanized locus (G294A, G295S, G298S, A315T, and M337V). Over-expression of TARDBP A315T is toxic in two different C. elegans models and TARDBP M337V is toxic in two different C. elegans models (Vaccaro, Tauffenberger, Aggad, et al. 2012; Liachko, Guthrie, and Kraemer 2010; Zhang et al. 2012). C. elegans models for the other alleles have not been reported previously.
Assess neurodegeneration for clinical variants. Only insertion of hTARDBP-G295S yielded a significant defect versus hTARDBP-WT (Panel I). Future work will likely require confirmation of the G295S defect with the generation and testing of another independently-derived allele. For the remaining alleles (G294A, G298S, A315T, and M337V), no significant increases in stress-induced neurodegeneration were observed, compared to hTARDBP-WT, using this assay.
","references":[{"reference":"Arribere JA, Bell RT, Fu BX, Artiles KL, Hartman PS, Fire AZ. 2014. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics 198: 837-46.
","pubmedId":"25161212","doi":""},{"reference":"Baskoylu SN, Yersak J, O'Hern P, Grosser S, Simon J, Kim S, et al., Hart AC. 2018. Single copy/knock-in models of ALS SOD1 in C. elegans suggest loss and gain of function have different contributions to cholinergic and glutamatergic neurodegeneration. PLoS Genet 14: e1007682.
","pubmedId":"30296255","doi":""},{"reference":"Faber PW, Alter JR, MacDonald ME, Hart AC. 1999. Polyglutamine-mediated dysfunction and apoptotic death of a Caenorhabditis elegans sensory neuron. Proc Natl Acad Sci U S A 96: 179-84.
","pubmedId":"9874792","doi":""},{"reference":"Kim H, Ishidate T, Ghanta KS, Seth M, Conte D Jr, Shirayama M, Mello CC. 2014. A co-CRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197: 1069-80.
","pubmedId":"24879462","doi":""},{"reference":"Liachko NF, Guthrie CR, Kraemer BC. 2010. Phosphorylation promotes neurotoxicity in a Caenorhabditis elegans model of TDP-43 proteinopathy. J Neurosci 30: 16208-19.
","pubmedId":"21123567","doi":""},{"reference":"McCormick, Kathryn, Trisha Brock, Matthew Wood, Lan Guo, Kolt McBride, Christine Kim, Lauren Resch, et al. 2021. “A Gene Replacement Humanization Platform for Rapid Functional Testing of Clinical Variants in Epilepsy-Associated STXBP1.” bioRxiv. https://doi.org/10.1101/2021.08.13.453827.
Medley JC, Hebbar S, Sydzyik JT, Zinovyeva AY. 2022. Single nucleotide substitutions effectively block Cas9 and allow for scarless genome editing in Caenorhabditis elegans. Genetics 220: .
","pubmedId":"34791245","doi":""},{"reference":"Nass R, Hall DH, Miller DM 3rd, Blakely RD. 2002. Neurotoxin-induced degeneration of dopamine neurons in Caenorhabditis elegans. Proc Natl Acad Sci U S A 99: 3264-9.
","pubmedId":"11867711","doi":""},{"reference":"Redemann S, Schloissnig S, Ernst S, Pozniakowsky A, Ayloo S, Hyman AA, Bringmann H. 2011. Codon adaptation-based control of protein expression in C. elegans. Nat Methods 8: 250-2.
","pubmedId":"21278743","doi":""},{"reference":"Ryan VH, Perdikari TM, Naik MT, Saueressig CF, Lins J, Dignon GL, et al., Fawzi NL. 2021. Tyrosine phosphorylation regulates hnRNPA2 granule protein partitioning and reduces neurodegeneration. EMBO J 40: e105001.
","pubmedId":"33349959","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Aggad D, Rouleau G, Drapeau P, Parker JA. 2012. Mutant TDP-43 and FUS cause age-dependent paralysis and neurodegeneration in C. elegans. PLoS One 7: e31321.
","pubmedId":"22363618","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Aggad D, Rouleau G, Drapeau P, Parker JA. 2012. Mutant TDP-43 and FUS cause age-dependent paralysis and neurodegeneration in C. elegans. PLoS One 7: e31321.
","pubmedId":"22363618","doi":""},{"reference":"Vaccaro A, Tauffenberger A, Ash PE, Carlomagno Y, Petrucelli L, Parker JA. 2012. TDP-1/TDP-43 regulates stress signaling and age-dependent proteotoxicity in Caenorhabditis elegans. PLoS Genet 8: e1002806.
","pubmedId":"22792076","doi":""},{"reference":"Zhang T, Hwang HY, Hao H, Talbot C Jr, Wang J. 2012. Caenorhabditis elegans RNA-processing protein TDP-1 regulates protein homeostasis and life span. J Biol Chem 287: 8371-82.
","pubmedId":"22232551","doi":""}],"suggestedReviewer":{"name":"Todd Lamitina, Aimee Kao, Brian Kraemer, John Pierce, Alex Parker","WBId":""},"title":"Generation of a C. elegans tdp-1 null allele and humanized TARDBP containing human disease-variants.
","reviews":[]}]}}},"pageContext":{"id":"299eb96f-dfa6-4c21-96d1-59ed9cebfa65","correctionId":"micropub-biology-002225"}}, "staticQueryHashes": ["2114697108"]}