Stem cell proliferation rates must be precisely regulated as insufficient proliferation leads to tissue loss, whereas excessive proliferation causes tumorigenesis and cancer. A homeostatic balance is therefore achieved through feedback loops that adjust stem/progenitor cell proliferation rates to match the demand for their differentiated progeny. While such a homeostatic feedback mechanism adjusts germline stem cell (GSC) proliferation rates to oocyte needs in the Caenorhabditis elegans adult hermaphrodite germline, its inner workings are incompletely understood. Here we show that the Ga GOA-1/GNAO1 is required specifically in the gonadal sheath cells to non-autonomously promote GSC quiescence in spermless hermaphrodites. Given that dysregulation of G protein signalling is frequently observed in human cancers, Gα dependent homeostatic control of stem cell proliferation may represent a conserved tumour suppressive mechanism.
","acknowledgements":"","authors":[{"affiliations":["Université du Québec à Trois-Rivières, Trois-Rivières, Québec, Canada"],"departments":["Département de Biologie Médicale"],"credit":["writing_originalDraft","conceptualization","dataCuration","formalAnalysis","methodology","validation"],"email":"armichaudhary97@gmail.com","firstName":"Armi M","lastName":"Chaudhari","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7908-2157"},{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["methodology"],"email":"thuminhnguyen1909@gmail.com","firstName":"Minh Thu ","lastName":"Nguyen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Université du Québec à Trois-Rivières, Trois-Rivières, Québec, Canada."],"departments":["Département de Biologie Médicale",""],"credit":["conceptualization","fundingAcquisition","investigation","project","resources","supervision","validation","writing_reviewEditing","formalAnalysis"],"email":"patrick.narbonne@uqtr.ca","firstName":"Patrick","lastName":"Narbonne","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":"https://portal.micropublication.org/uploads/3679eeceac8cfc23eea9ee79f0287d24.csv"},"extendedData":[],"funding":"Research in the Narbonne Laboratory is funded by grants awarded to PN from the Fondation Marcel & Rolande Gosselin, the Natural Sciences and Engineering Research Council of Canada (RGPIN-2026-05498), the Fonds de recherche du Québec – Santé (310643) and the Canadian Institutes of Health Research (PJT-169138). AC is financially supported by a PBEEE scholarship (332795) and a doctoral scholarship from the Fonds de recherche du Québec – Santé (367752). MTN was supported by the Canada-Asean Scholarship and Educational Exchanges for Development (SEED) program.
","image":{"url":"https://portal.micropublication.org/uploads/a17fc400e86aa0f11fe9fe7e52ef4913.jpg"},"imageCaption":"(A) Model for homeostatic regulation of germline stem/progenitor cell (GSC) proliferation rates in adult C. elegans hermaphrodites. GSCs located in the distal progenitor zone (PZ) generate daughters that, upon exiting the niche, differentiate into oocytes. Major sperm proteins (MSPs), released by sperm, stimulate oocyte maturation and ovulation via G-protein coupled receptors and cAMP signalling in the gonadal sheath cells (Govindan et al., 2006, 2009) to establish oocyte demand. A strong oocyte demand in turn promotes MPK-1/ERK-dependent GSC proliferation (Lee et al., 2007; Narbonne et al., 2017; Robinson-Thiewes et al., 2021). (B-E) The number of (B, D) diakinesis oocytes per gonad arm and (C, E) the GSC mitotic index of day-1 adult (A1) hermaphrodites of the indicated genotypes were scored. Each bar represents the mean ± standard deviation and each point represent the value from a single gonad arm; one to two arms per individual were scored. Triple asterisks indicate statistical significance vs the wild-type (P<0.001).Statistical analyses used a one-way ANOVA followed by Tukey's multiple comparisons for (B, D) and the Kruskal–Wallis test followed by Dunn’s multiple comparisons for (C, E). ns: not significant). (F) Representative differential interference contrast (DIC) micrographs of proximal gonads of A1 hermaphrodites of the indicated genotypes. The bottom panel shows the epifluorescence signal from the sheath-expressed Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] (abbreviated as Plim-7::GOA-1::GFP) construct as a green overlay. (G) The sheath and spermatheca (Sp) expression pattern and levels from the single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021) were similar in A1 (top) control and (bottom) feminized fog-1(lf) mutants. (F-G) Scale bars, 50 μm. (H) The (Top) oma-1(ø); oma-2(lf) double mutant maintained a state of relatively stable oocyte hyperplasia while (bottom) goa-1(lf); oma-1(ø); oma-2(lf) triples underwent oocyte hyperaccumulation. A tumour penetrance percentage is shown as a coloured vertical bar on the right (blue, stable hyperplasia; red, oocytes hyperaccumulation/differentiated tumour). All strains contain cpSi42[Pmex-5::mNG::PLCδ-PH::tbb-2 3'UTR + unc-119(+)], marking germ membranes with green fluorescence. Scale bar, 100 μm. (B-H) Alleles, gsa-1(ce94)gf, fog-1(q253)ts, fog-1(q785)ø, goa-1(n1134)lf, vsSi32[goa-1::GFP + unc-119(+)], narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry], oma-1(zu405te33)ø , oma-2(te51)lf.
","imageTitle":"GOA-1 suppresses GSC proliferation from the gonadal sheath cells
","methods":"Methods
C. elegans strains were maintained at 15oC unless otherwise indicated on standard nematode growth medium (NGM) seeded with E. coli (OP50). The Bristol (N2) isolate served as wild-type throughout (Brenner, 1974). Table 1 provides a complete list of the C. elegans strains and reagents used in this work.
Plasmid and transgenic strain
We used the Gibson method (Gibson et al., 2009) for plasmid assembly; primers are listed in Table 1. To achieve sheath-specific goa-1 rescue, the LX2060 strain carrying a single-copy insertion of a GOA-1::GFP translational fusion driven by 5kb of goa-1 promoter (Kumar et al., 2021) was used to amplify the goa-1 N-term::GFP::goa-1 C-term genomic sequence (~ 4.5 kb). The resulting fragment was inserted downstream of the lim-7 promoter in a vector derived from pGC240 (Voutev et al. 2009). The integrity of the resulting pCAM37 plasmid was confirmed by XbaI restriction digestion. The microinjection mix consisted of three plasmids: pCAM37 at 50 ng/µL, pCFJ104 at 5 ng/µL (Frokjær-Jensen et al., 2008) and pKSII as carrier DNA at 150 ng/µL. The mixture was microinjected into the germline syncytium of wild-type hermaphrodites (Mello et al., 1991) to establish and select an array that was subsequently crossed into the fog-1(ø) goa-1(lf) double mutant for assaying its rescuing activity.
Imaging and image processing
All hermaphrodites used for imaging or scoring were synchronized by picking late-L4 stage larvae, based on vulva development (Seydoux et al., 1993), to a new plate that was upshifted to 25 °C for an additional 24 hours to generate day-1 adults (referred to as A1) (Narbonne et al., 2015, 2017; Robinson-Thiewes et al., 2021). For live imaging, the resulting A1 hermaphrodites were immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad.
Differential interference contrast (DIC) and epifluorescence images were acquired at 1 µm z-intervals using a Plan-Apochromat 20× dry objective (NA 0.8) mounted on an inverted Zeiss Axio Observer.Z1 microscope. For epifluorescence (Fig. 1G-H), samples were excited by a LED module at 488nm (50% intensity, 100ms exposure) and emission was collected at 500-550nm. Stitching and deconvolution were performed using the Zen 3.8 software. For the high-resolution confocal fluorescence acquisition shown as a pseudo-DIC overlay in Fig. 1F (the Plim-7::GOA-1::GFP rescue image), coverslips were sealed with VALAP (1:1:1 Vaseline, lanolin, paraffin), and a single focal plane was acquired using a Leica Microsystems Stellaris 5 confocal microscope equipped with an HC PL APO CS2 63×/1.30 numerical aperture oil immersion objective. Samples were excited by a 488nm laser (5% intensity) and emission was collected at 507-528nm with a pinhole setting of 1. Specimens were digitally straightened using ImageJ.
For fog-1(lf), late-L4 hermaphrodites were upshifted from 15°C to 25°C and maintained at this temperature along with their F1 progeny for 3 days to prevent spermatogenesis (Barton & Kimble, 1990). The resulting late-L4 feminized F1 hermaphrodites were transferred onto fresh plates at 25°C based on vulval morphology (Seydoux et al., 1993) and allowed to develop for another 24 hours to obtain A1. For the fog-1(ø) goa-1(lf) strain, non-fluorescent late-L4 hermaphrodites were picked from asynchronous cultures at 15°C onto fresh plates at 25 °C. In both cases, the resulting feminized A1 were collected, immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad. Oocyte number per gonad arm was quantified by DIC microscopy by counting morphologically distinct diakinesis-stage oocytes extending distally from the spermatheca.
The progenitor zone (PZ)/GSC mitotic index (MI) was assessed following a previously established protocol (Crittenden et al., 2006; Robinson-Thiewes et al., 2021). In brief, A1 hermaphrodites prepared as above were picked in a drop of 1X PBS placed on a coverslip and rapidly dissected using a surgical needle. The coverslip was then flipped onto a poly-L-lysine-coated slide and subjected to a standard −80°C freeze-crack procedure. Samples were subsequently fixed in −20°C methanol for 1 minute and post-fixed in a 3.7% paraformaldehyde solution (3.7% paraformaldehyde, 1X PBS, 0.08 M HEPES, 1.6 mM MgSO4, 0.8 mM EGTA, pH 7.4) for 30 minutes. After fixation, gonads were washed twice (10 minutes each) in PBST (PBS + 0.1% Tween 20) and then blocked in PBST + 3% BSA for 1 hour at room temperature. Primary antibody staining was performed overnight at 4°C using polyclonal rabbit anti-WAPL-1 (1:500, Sdix #4930.00.02) to label germline stem cells (GSCs) and their proliferative progeny, along with mouse monoclonal anti-phospho[Ser10]-histone H3 antibodies (1:250, Cell Signaling #9706) to mark G2/M-phase nuclei (Kocsisova et al., 2018). The samples were washed three times (10 minutes each) in PBST before incubation with A488-conjugated goat anti-mouse (Cat# A-11029; RRID:AB138404) and A546-conjugated goat anti-rabbit (Cat# A-11035; RRID:AB143051) (1:500 each) secondary antibodies for 1 hour at room temperature. Slides were washed three times with PBST and briefly stained with 0.7 μg/mL 4′,6-diamidino-2-phenylindole (DAPI) to visualize all nuclei. VectashieldTM mounting medium (Vector labs #H1900) was then applied, and the coverslip was sealed with nail polish. Prepared slides were stored at -20°C until they were imaged. PZ nuclei counting in 3 dimensions was partially automated using an ImageJ plugin developed by Dr Jane Hubbard's laboratory (Korta et al., 2014) .
Differentiated germline tumour scoring
Strains were maintained at 25°C, and staged by picking GFP negative goa-1(lf); oma-1(ø); oma-2(lf) homozygote late-L4s to a new plate at 25°C. The resulting animals were imaged 48 hours later (at A2). We classified individuals as tumorous if oocyte-like germ cells filled the uterus and as non-tumorous if the uterus remained largely empty. In Fig. 1H, the vertical bars at the right represent the percentage of animals showing each of these two phenotypes, with blue indicating non-tumorous and red indicating tumorous (Clouet et al., 2025).
Statistical analysis
All bar/dot plots were generated using GraphPad Prism 10.0. For each dataset, normality was verified using the Shapiro-Wilk test, and variance equality was assessed using the Brown-Forsythe test for multi-group comparisons. Tests were chosen according to the following criteria. For multi-group comparisons where all distributions were normal and variances equal, the one-way ANOVA with Tukey's multiple comparisons was used. When distributions were non-Gaussian, the Kruskal-Wallis test with Dunn's multiple comparisons was applied instead. Tests used for each dataset are indicated in the figure legend.
","reagents":"
Strain/ plasmid name | Name in text/ description | Genotype/ source material | Source/ oligo sequences (5’-> 3’) |
N2 | wild-type (WT) | wild-type | Caenorhabditis Genetics Center (Brenner, 1974) |
JK3743 | fog-1(ø) | GFP-negative progeny of fog-1(q785)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | Caenorhabditis Genetics Center (Morgan et al., 2010) |
JK546 | fog-1(lf) | fog-1(q253)ts I | Caenorhabditis Genetics Center (Barton & Kimble, 1990) |
MT2426 | goa-1(lf) | goa-1(n1134) I | Caenorhabditis Genetics Center |
KG524 | gsa-1(gf) | gsa-1(ce94)gf I | (Castaneda et al., 2020) |
UM307 | fog-1(ø) goa-1(lf) | GFP-negative progeny of fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | (Narbonne et al., 2015) |
UTR498 | gsa-1(gf) fog-1(lf) | gsa-1(ce94)gf fog-1(q253)ts I | This study |
UTR873 | sheath::GOA-1(+) | narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study; see primer info at the end of table (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) |
UTR874 | fog-1(ø) goa-1(lf); sheath::GOA-1(+) | fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study, (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) |
LX2060 | Pgoa-1::GOA-1::GFP | vsSi32[Pgoa-1::GOA-1::GFP + unc-119(+)] III. | (Kumar et al., 2021) |
UTR508 | fog-1(lf), Pgoa-1::GOA-1::GFP | fog-1(q253)ts I, vsSi32[Pgoa-1::GOA-1::GFP + unc-119(+)] III. | This study |
UTR19 | oma-1(ø); oma-2(lf) | cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | (Clouet et al., 2025) |
UTR426 | goa-1(lf); oma-1,2(-) | goa-1(n1134) I; cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | This study |
pCAM37 | Plim-7::GOA-1 N-Term::GFP::GOA-1 C-Term | LX2060 gDNA for the insert; pXA9 (derived from pGC240 (Voutev et al. 2009) for the backbone. | Insert forward: TTGGAGGGTACCGGTAGAAAAAATGGGTTGTACCATGTCACAGGA Insert reverse: AGGGGAAACAAAATGAAGAGAATTTAATACAAGCCGCATCCACGAAG Backbone forward: CTTCGTGGATGCGGCTTGTATTAAATTCTCTTCATTTTGTTTCCCCT Backbone reverse: TCCTGTGACATGGTACAACCCATTTTTTCTACCGGTACCCTCCAA
|
E. coli | OP50 | Standard E. coli bacteria used as C. elegans food | Caenorhabditis Genetics Center |
Table 1. C. elegans strains and reagents used in this study.
","patternDescription":"Description
Stem cells must divide enough to replace cells lost to turnover and be able to increase their output in response to injuries. Yet their proliferation must also be constrained to prevent tissue overgrowth and tumorigenesis when differentiated cell turnover is reduced. This balance is achieved through homeostatic feedback loops that monitor differentiated tissue status and modulate stem/progenitor cell proliferation accordingly. At the molecular level, G protein-coupled receptor (GPCR) signalling has emerged as a key regulator of stem cell proliferation and homeostasis across diverse systems. GPCRs mediate stem cell responses to extracellular cues through heterotrimeric G proteins, with stimulatory (Gαs) and inhibitory (Gαi/o) pathways modulating stem cell division rates, self-renewal, and differentiation in multiple contexts (Kobayashi et al., 2010; Layden et al., 2010; Pedro et al., 2020). In Drosophila males for instance, germline stem cells (GSCs) increase their division frequency in response to mating-induced sperm depletion through a germ-autonomous G protein-dependent mechanism, directly demonstrating that GPCR signaling can couple stem cell output to physiological demand (Malpe et al., 2020). However, whether G protein signalling can non-autonomously contribute to tissue homeostasis has remained unclear.
The Caenorhabditis elegans germline provides a powerful in vivo system to elucidate how stem cell proliferation homeostasis is controlled. Hermaphrodites produce a finite amount of sperm during larval development before shifting irreversibly to oocyte production in adults, with oogenesis continuing at a fast pace until sperm reserves are depleted (Fig. 1A). As sperm-secreted major sperm proteins (MSPs) actively stimulate meiotic maturation and ovulation (Miller et al., 2001), once sperm reserves are depleted, arrested oocytes accumulate until a homeostatic feedback signal suppresses GSC proliferation/differentiation to stabilize a state of oocyte hyperplasia (Morgan et al., 2010; Narbonne et al., 2015, 2017; Cinquin et al., 2016; Valet & Narbonne, 2022).
The antagonistic Gαo/i GOA-1/GNAO1 and Gαs GSA-1/GNAS1 have been identified as critical regulators of MSP/ovulation signalling, where the loss of goa-1 results in spontaneous ovulation in the absence of sperm/MSPs while conversely, the loss of gsa-1 activity prevents ovulation, even in the presence of sperm/MSPs (Govindan et al., 2006, 2009). Interestingly, a goa-1 loss-of-function (lf) further impaired GSC proliferation homeostasis in feminized fog-1(ø) spermless hermaphrodites (Narbonne et al., 2015). However, and especially since the loss of goa-1 is pleiotropic, also affecting behaviour and locomotion (Ségalat et al., 1995; Mendel et al., 1995), it remained unclear if the disruption of GSC proliferation homeostasis specifically resulted from the very same role that goa-1 has in MSP signal transduction.
Germ-specific RNAi and elegant mosaic analyses unequivocally supported a requirement for goa-1 and gsa-1 in the somatic gonad for the regulation of oocyte maturation and ovulation (Govindan et al., 2006, 2009; Korswagen et al., 1997). Further, a single mosaic individual for acy-4, encoding the adenylate cyclase acting downstream of these Gα proteins, more specifically indicated a sheath cell requirement for this gene in ovulation control (Govindan et al., 2009). However, whether gsa-1 and goa-1 activities are also acting specifically within the gonadal sheath cells, rather than in another somatic gonad tissue, has remained unconfirmed.
While the gonadal sheath and spermatheca cells derive from a common somatic precursor, GSA-1 was recently implicated in the control of spermatheca contractility through a molecular cascade that overlaps with MSP signalling (Castaneda et al., 2020). Given this shared developmental origin and our recent discovery that spermatheca neck contractility was key in preventing ovulation in feminized hermaphrodites (Deng et al., 2025), we deemed it important to determine whether sheath-specific goa-1 activity was sufficient to regulate both ovulation and germline stem cell proliferation homeostasis in feminized hermaphrodites.
We first reasoned that if GOA-1 and GSA-1 have opposing activities within both MSP signalling and homeostatic GSC proliferation control, activating gsa-1 activity with a gain-of-function (gf) allele should prevent GSC downregulation in feminized hermaphrodites, like the loss of goa-1. Consistent with this, gsa-1(gf) prevented oocyte accumulation in feminized hermaphrodites and blocked the downregulation of GSC proliferation (Fig. 1B-C). To directly test the gonadal sheath requirement for goa-1, we used a standard extrachromosomal array transgene (Mello et al., 1991) to restore goa-1 specifically in this tissue within feminized goa-1(lf) mutants, using the sheath-specific lim-7 promoter (Voutev et al. 2009). As conventional N- or C-terminal tagging of Gα proteins can impair their function (Hynes et al., 2004), Kumar et al. inserted a GFP tag between residues 117-118 of GOA-1 to create a functional single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021). We used this strain as a starting point to generate a Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] extrachromosomal array, abbreviated as Plim-7::GOA-1::GFP. The resulting transgene effectively rescued both oocyte accumulation and GSC MI downregulation in fog-1(ø) goa-1(lf) hermaphrodites (Fig. 1D-F). We also examined whether sheath or spermathecae expression from a Pgoa-1::GOA-1::GFP single-copy transgene (Kumar et al., 2021) were altered by feminization, but no obvious changes were observed (Fig. 1G). Together with earlier findings (Govindan et al., 2006, 2009), our results provide strong evidence that GOA-1 acts specifically within the gonadal sheath to prevent spontaneous ovulation events in the absence of sperm/MSP to permit oocyte accumulation, and at the same time yet indirectly, to non-autonomously promote homeostatic downregulation of GSC proliferation.
Similar to the loss of GOA-1, loss of the AMPK α-catalytic subunit AAK-1 caused spontaneous ovulation and prevented homeostatic GSC downregulation in feminized hermaphrodites (Narbonne et al., 2017). The specific suppression of oocyte maturation through the inactivation of OMA-1,2 proteins (Detwiler et al., 2001) induced oocyte accumulation in aak-1(ø) mutants but did not reinstate the associated GSC downregulation, and led to the formation of differentiated germline tumours (Narbonne et al., 2017; Valet & Narbonne, 2022). We find that similarly, reduced goa-1 activity in an oma-1(ø); oma-2(lf) background provokes differentiated germline tumours (Fig. 1H). The similarity of the goa-1(lf) and aak-1(ø) phenotypes raises the intriguing possibility that aak-1 may essentially permit sheath Gα signals to suppress oocyte maturation and ovulation in the absence of sperm.
Altogether, our results reveal that the Gα GOA-1/GNAO1 ensures homeostatic GSC downregulation in spermless adult hermaphrodite C. elegans non-autonomously from the gonadal sheath cells, likely through its known roles in MSP responses and ovulation control. G-protein signalling may therefore non-autonomously regulate stem cell proliferation rates in various organisms and tissues in addition to having cell autonomous roles.
","references":[{"reference":"Brenner S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77(1), 71–94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Barton MK, Kimble J. 1990. fog-1, a regulatory gene required for specification of spermatogenesis in the germ line of Caenorhabditis elegans.. Genetics 125: 29-39.
","pubmedId":"","doi":"10.1093/genetics/125.1.29"},{"reference":"Castaneda PG, Cecchetelli AD, Pettit HN, Cram EJ. 2020. Gα/GSA-1 works upstream of PKA/KIN-1 to regulate calcium signaling and contractility in the Caenorhabditis elegans spermatheca. PLOS Genetics 16: e1008644.
","pubmedId":"","doi":"10.1371/journal.pgen.1008644"},{"reference":"Cinquin A, Chiang M, Paz A, Hallman S, Yuan O, Vysniauskaite I, Fowlkes CC, Cinquin O. 2016. Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line. PLOS Genetics 12: e1005985.
","pubmedId":"","doi":"10.1371/journal.pgen.1005985"},{"reference":"Clouet A, Valet M, Dufour B, Rieger J, Lechasseur X, Zoumabo ATrsC, et al., Narbonne. 2025. Non-autonomous PMK-1/p38 MAPK signaling ensures homeostatic downregulation of germline stem cell proliferation in\n C. elegans. : 10.1101/2025.09.24.678176.
","pubmedId":"","doi":"10.1101/2025.09.24.678176"},{"reference":"Crittenden, S. L., Leonhard, K. A., Byrd, D. T., & Kimble, J. (2006). Cellular Analyses of the Mitotic Region in the Caenorhabditis elegans Adult Germ Line. Molecular Biology of the Cell, 17, 3051–3061
","pubmedId":"","doi":"10.1091/mbc.E06"},{"reference":"Deng J, Chaudhari AM, Gagné O, Roy V, Dufour B, Martel PO, Simard MJ, Narbonne P. 2025. DAF-18/PTEN prevents oocyte wastage in spermless\n C. elegans\n hermaphrodites by blocking spermatheca neck dilation through RHO-1/RhoA disinhibition. : 10.1101/2025.09.16.676617.
","pubmedId":"","doi":"10.1101/2025.09.16.676617"},{"reference":"Detwiler MR, Reuben M, Li X, Rogers E, Lin R. 2001. Two Zinc Finger Proteins, OMA-1 and OMA-2, Are Redundantly Required for Oocyte Maturation in C. elegans. Developmental Cell 1: 187-199.
","pubmedId":"","doi":"10.1016/s1534-5807(01)00026-0"},{"reference":"Frøkjær-Jensen C, Wayne Davis M, Hopkins CE, Newman BJ, Thummel JM, Olesen SrP, Grunnet M, Jorgensen EM. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics 40: 1375-1383.
","pubmedId":"","doi":"10.1038/ng.248"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Govindan JA, Cheng H, Harris JE, Greenstein D. 2006. Gαo/i and Gαs Signaling Function in Parallel with the MSP/Eph Receptor to Control Meiotic Diapause in C. elegans. Current Biology 16: 1257-1268.
","pubmedId":"","doi":"10.1016/j.cub.2006.05.020"},{"reference":"Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D. 2009. Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation inC. elegans. Development 136: 2211-2221.
","pubmedId":"","doi":"10.1242/dev.034595"},{"reference":"Hynes TR, Hughes TE, Berlot CH. Undefined. Cellular Localization of GFP-Tagged α Subunits. G Protein Signaling : 233-246.
","pubmedId":"","doi":"10.1385/1-59259-430-1:233"},{"reference":"Kobayashi NR, Hawes SM, Crook JM, Pébay A. 2010. G-protein Coupled Receptors in Stem Cell Self-Renewal and Differentiation. Stem Cell Reviews and Reports 6: 351-366.
","pubmedId":"","doi":"10.1007/s12015-010-9167-9"},{"reference":"Kocsisova Z, Kornfeld K, Schedl T. 2018. Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans. BMC Developmental Biology 18: 10.1186/s12861-018-0171-7.
","pubmedId":"","doi":"10.1186/s12861-018-0171-7"},{"reference":"Korswagen HC, Park JH, Ohshima Y, Plasterk RH. 1997. An activating mutation in a Caenorhabditis elegans Gs protein induces neural degeneration.. Genes & Development 11: 1493-1503.
","pubmedId":"","doi":"10.1101/gad.11.12.1493"},{"reference":"Korta DZ, Tuck S, Hubbard EJA. 2012. S6K links cell fate, cell cycle and nutrient response inC. elegansgermline stem/progenitor cells. Development 139: 859-870.
","pubmedId":"","doi":"10.1242/dev.074047"},{"reference":"Kumar S, Olson AC, Koelle MR. 2021. The neural G protein Gαo tagged with GFP at an internal loop is functional in\n Caenorhabditis elegans. G3 Genes|Genomes|Genetics 11: 10.1093/g3journal/jkab167.
","pubmedId":"","doi":"10.1093/g3journal/jkab167"},{"reference":"Layden BT, Newman M, Chen F, Fisher A, Lowe WL. 2010. G Protein Coupled Receptors in Embryonic Stem Cells: A Role for Gs-Alpha Signaling. PLoS ONE 5: e9105.
","pubmedId":"","doi":"10.1371/journal.pone.0009105"},{"reference":"Lee MH, Ohmachi M, Arur S, Nayak S, Francis R, Church D, Lambie E, Schedl T. 2007. Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling inCaenorhabditis elegansGermline Development. Genetics 177: 2039-2062.
","pubmedId":"","doi":"10.1534/genetics.107.081356"},{"reference":"Malpe MS, McSwain LF, Kudyba K, Ng CL, Nicholson J, Brady M, et al., Schulz. 2020. G-protein signaling is required for increasing germline stem cell division frequency in response to mating in Drosophila males. Scientific Reports 10: 10.1038/s41598-020-60807-8.
","pubmedId":"","doi":"10.1038/s41598-020-60807-8"},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences.. The EMBO Journal 10: 3959-3970.
","pubmedId":"","doi":"10.1002/j.1460-2075.1991.tb04966.x"},{"reference":"Mendel JE, Korswagen HC, Liu KS, Hajdu-Cronin YM, Simon MI, Plasterk RHA, Sternberg PW. 1995. Participation of the Protein G\n o\n in Multiple Aspects of Behavior in\n C. elegans. Science 267: 1652-1655.
","pubmedId":"","doi":"10.1126/science.7886455"},{"reference":"Miller MA, Nguyen VQ, Lee MH, Kosinski M, Schedl T, Caprioli RM, Greenstein D. 2001. A Sperm Cytoskeletal Protein That Signals Oocyte Meiotic Maturation and Ovulation. Science 291: 2144-2147.
","pubmedId":"","doi":"10.1126/science.1057586"},{"reference":"Morgan DE, Crittenden SL, Kimble J. 2010. The C. elegans adult male germline: Stem cells and sexual dimorphism. Developmental Biology 346: 204-214.
","pubmedId":"","doi":"10.1016/j.ydbio.2010.07.022"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2015. daf-18/PTEN locally antagonizes insulin signalling to couple germline stem cell proliferation to oocyte needs inC. elegans. Development : 10.1242/dev.130252.
","pubmedId":"","doi":"10.1242/dev.130252"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2017. DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation. PLOS Genetics 13: e1006738.
","pubmedId":"","doi":"10.1371/journal.pgen.1006738"},{"reference":"Pedro MP, Lund K, Iglesias-Bartolome R. 2020. The landscape of GPCR signaling in the regulation of epidermal stem cell fate and skin homeostasis. Stem Cells 38: 1520-1531.
","pubmedId":"","doi":"10.1002/stem.3273"},{"reference":"Robinson-Thiewes S, Dufour B, Martel PO, Lechasseur X, Brou AAD, Roy V, et al., Narbonne. 2021. Non-autonomous regulation of germline stem cell proliferation by somatic MPK-1/MAPK activity in C. elegans. Cell Reports 35: 109162.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109162"},{"reference":"Ségalat L, Elkes DA, Kaplan JM. 1995. Modulation of Serotonin-Controlled Behaviors by G\n o\n in\n Caenorhabditis elegans. Science 267: 1648-1651.
","pubmedId":"","doi":"10.1126/science.7886454"},{"reference":"Seydoux G, Salvage C, Greenwald I. 1993. Isolation and Characterization of Mutations Causing Abnormal Eversion of the Vulva in Caenorhabditis elegans. Developmental Biology 157: 423-436.
","pubmedId":"","doi":"10.1006/DBIO.1993.1146"},{"reference":"Valet M, Narbonne P. 2022. Formation of benign tumors by stem cell deregulation. PLOS Genetics 18: e1010434.
","pubmedId":"","doi":"10.1371/journal.pgen.1010434"},{"reference":"Voutev R, Keating R, Jane Albert Hubbard E, Vallier LG. 2008. Characterization of the\n Caenorhabditis elegans\n Islet\n LIM‐homeodomain ortholog,\n lim‐7. FEBS Letters 583: 456-464.
","pubmedId":"","doi":"10.1016/j.febslet.2008.12.046"}],"title":"The Ga GOA-1/GNAO1 non-autonomously promotes germline stem cell quiescence in feminized C. elegans hermaphrodites from the gonadal sheath cells
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"b64fd0e1-a5cb-4ce7-881e-6112c640373f","decision":"revise","abstract":"Stem cell proliferation rates must be precisely regulated as insufficient proliferation leads to tissue loss, whereas excessive proliferation causes tumorigenesis and cancer. A homeostatic balance is therefore achieved through feedback loops that adjust stem/progenitor cell proliferation rates to match the demand for their differentiated progeny. While such a homeostatic feedback mechanism adjusts germline stem cell (GSC) proliferation rates to oocyte needs in the Caenorhabditis elegans adult hermaphrodite germline, its inner workings are incompletely understood. Here we show that the Gα GOA-1/GNAO1 is required specifically in the gonadal sheath cells to non-autonomously promote GSC quiescence in spermless hermaphrodites. Given that dysregulation of G protein signalling is frequently observed in human cancers, Gα dependent homeostatic control of stem cell proliferation may represent a conserved tumour suppressive mechanism.
","acknowledgements":"","authors":[{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["writing_originalDraft","conceptualization","dataCuration","formalAnalysis","methodology","validation"],"email":"armichaudhary97@gmail.com","firstName":"Armi M","lastName":"Chaudhari","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7908-2157"},{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["methodology"],"email":"thuminhnguyen1909@gmail.com","firstName":"Minh Thu ","lastName":"Nguyen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale",""],"credit":["conceptualization","fundingAcquisition","investigation","project","resources","supervision","validation","writing_reviewEditing","formalAnalysis"],"email":"patrick.narbonne@uqtr.ca","firstName":"Patrick","lastName":"Narbonne","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Research in the Narbonne Laboratory is funded by grants awarded to PN from the Fondation Marcel & Rolande Gosselin, the Natural Sciences and Engineering Research Council of Canada (RGPIN-2026-05498), the Fonds de recherche du Québec – Santé (310643) and the Canadian Institutes of Health Research (PJT-169138). AC is financially supported by a PBEEE scholarship (332795) and a doctoral scholarship from the Fonds de recherche du Québec – Santé (367752). MTN was supported by the Canada-Asean Scholarship and Educational Exchanges for Development (SEED) program.
","image":{"url":"https://portal.micropublication.org/uploads/8d7d887bdbbb41d3ae1983db765f2c9b.jpg"},"imageCaption":"(A) Model for homeostatic regulation of germline stem/progenitor cell (GSC) proliferation rates in adult C. elegans hermaphrodites. GSCs located in the distal progenitor zone (PZ) generate daughters that, upon exiting the niche, differentiate into oocytes. Major sperm proteins (MSPs), released by sperm, stimulate oocyte maturation and ovulation via G-protein coupled receptors and cAMP signalling in the gonadal sheath cells (Govindan et al., 2006, 2009) to establish oocyte demand. A strong oocyte demand in turn promotes MPK-1/ERK-dependent GSC proliferation (Lee et al., 2007; Narbonne et al., 2017; Robinson-Thiewes et al., 2021). (B-E) The number of (B, D) diakinesis oocytes per gonad arm and (C, E) the GSC mitotic index of day-1 adult (A1) hermaphrodites of the indicated genotypes were scored. Each bar represents the mean ± standard deviation and each point represent the value from a single gonad arm; one to two arms per individual were scored. Triple asterisks indicate statistical significance vs the wild-type (P<0.001).Statistical analyses used a one-way ANOVA followed by Tukey's multiple comparisons for (B, D) and the Kruskal–Wallis test followed by Dunn's multiple comparisons for (C, E). ns: not significant). (F) Representative differential interference contrast (DIC) micrographs of proximal gonads of A1 hermaphrodites of the indicated genotypes. The bottom panel shows the epifluorescence signal from the sheath-expressed Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] (abbreviated as Plim-7::GOA-1::GFP) construct as a green overlay. (G) The sheath and spermatheca (Sp) expression pattern and levels from the single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021) were similar in A1 (top) control and (bottom) feminized fog-1(lf) mutants. (F-G) Scale bars, 50 μm. (H) The (Top) oma-1(ø); oma-2(lf) double mutant maintained a state of relatively stable oocyte hyperplasia while (bottom) goa-1(lf); oma-1(ø); oma-2(lf) triples underwent oocyte hyperaccumulation. A tumour penetrance percentage is shown as a coloured vertical bar on the right (blue, stable hyperplasia; red, oocytes hyperaccumulation/differentiated tumour). All strains contain cpSi42[Pmex-5::mNG::PLCδ-PH::tbb-2 3'UTR + unc-119(+)], marking germ membranes with green fluorescence. Scale bar, 100 μm. (B-H) Alleles, gsa-1(ce94)gf, fog-1(q253)ts, fog-1(q785)ø, goa-1(n1134)lf, vsSi32[goa-1::GFP + unc-119(+)], narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry], oma-1(zu405te33)ø , oma-2(te51)lf.
","imageTitle":"GOA-1 suppresses GSC proliferation from the gonadal sheath cells
","methods":"C. elegans strains and maintenance
C. elegans strains were maintained at 15oC unless otherwise indicated on standard nematode growth medium (NGM) seeded with E. coli (OP50). The Bristol (N2) isolate served as wild-type throughout (Brenner, 1974). Table 1 provides a complete list of the C. elegans strains and reagents used in this work.
Plasmid and transgenic strain
We used the Gibson method (Gibson et al., 2009) for plasmid assembly; primers are listed in Table 1. To achieve sheath-specific goa-1 rescue, the LX2060 strain carrying a single-copy insertion of a GOA-1::GFP translational fusion driven by 5kb of goa-1 promoter (Kumar et al., 2021) was used to amplify the goa-1 N-term::GFP::goa-1 C-term genomic sequence (~ 4.5 kb). The resulting fragment was inserted downstream of the lim-7 promoter in a vector derived from pGC240 (Voutev et al. 2009). The integrity of the resulting pCAM37 plasmid was confirmed by XbaI restriction digestion. The microinjection mix consisted of three plasmids: pCAM37 at 50 ng/µL, pCFJ104 at 5 ng/µL (Frøkjær-Jensen et al., 2008) and pKSII as carrier DNA at 150 ng/µL. The mixture was microinjected into the germline syncytium of wild-type hermaphrodites (Mello et al., 1991) to establish and select an array that was subsequently crossed into the fog-1(ø) goa-1(lf) double mutant for assaying its rescuing activity.
Imaging and image processing
All hermaphrodites used for imaging or scoring were synchronized by picking late-L4 stage larvae, based on vulva development (Seydoux et al., 1993), to a new plate that was upshifted to 25 °C for an additional 24 hours to generate day-1 adults (referred to as A1) (Narbonne et al., 2015, 2017; Robinson-Thiewes et al., 2021). For live imaging, the resulting A1 hermaphrodites were immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad.
Differential interference contrast (DIC) and epifluorescence images were acquired at 1 µm z-intervals using a Plan-Apochromat 20× dry objective (NA 0.8) mounted on an inverted Zeiss Axio Observer.Z1 microscope. For epifluorescence (Fig. 1G-H), samples were excited by a LED module at 488 nm (50% intensity, 100 ms exposure) and emission was collected at 500-550 nm. Stitching and deconvolution were performed using the Zen 3.8 software. For the high-resolution confocal fluorescence acquisition shown as a pseudo-DIC overlay in Fig. 1F (the Plim-7::GOA-1::GFP rescue image), coverslips were sealed with VALAP (1:1:1 Vaseline, lanolin, paraffin), and a single focal plane was acquired using a Leica Microsystems Stellaris 5 confocal microscope equipped with an HC PL APO CS2 63×/1.30 numerical aperture oil immersion objective. Samples were excited by a 488 nm laser (5% intensity) and emission was collected at 507-528 nm with a pinhole setting of 1. Specimens were digitally straightened using ImageJ 1.53t.
Arrested oocyte quantification
For fog-1(lf), late-L4 hermaphrodites were upshifted from 15°C to 25°C and maintained at this temperature along with their F1 progeny for 3 days to prevent spermatogenesis (Barton & Kimble, 1990). The resulting late-L4 feminized F1 hermaphrodites were transferred onto fresh plates at 25°C based on vulval morphology (Seydoux et al., 1993) and allowed to develop for another 24 hours to obtain A1. For the fog-1(ø) goa-1(lf) strain, non-fluorescent late-L4 hermaphrodites were picked from asynchronous cultures at 15°C onto fresh plates at 25 °C. In both cases, the resulting feminized A1 were collected, immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad. Oocyte number per gonad arm was quantified by DIC microscopy by counting morphologically distinct diakinesis-stage oocytes extending distally from the spermatheca.
GSC mitotic index
The progenitor zone (PZ)/GSC mitotic index (MI) was assessed following a previously established protocol (Crittenden et al., 2006; Robinson-Thiewes et al., 2021). In brief, A1 hermaphrodites prepared as above were picked in a drop of 1X PBS placed on a coverslip and rapidly dissected using a surgical needle. The coverslip was then flipped onto a poly-L-lysine-coated slide and subjected to a standard −80°C freeze-crack procedure. Samples were subsequently fixed in −20°C methanol for 1 minute and post-fixed in a 3.7% paraformaldehyde solution (3.7% paraformaldehyde, 1X PBS, 0.08 M HEPES, 1.6 mM MgSO4, 0.8 mM EGTA, pH 7.4) for 30 minutes. After fixation, gonads were washed twice (10 minutes each) in PBST (PBS + 0.1% Tween 20) and then blocked in PBST + 3% BSA for 1 hour at room temperature. Primary antibody staining was performed overnight at 4°C using polyclonal rabbit anti-WAPL-1 (1:500, Sdix #4930.00.02) to label germline stem cells (GSCs) and their proliferative progeny, along with mouse monoclonal anti-phospho[Ser10]-histone H3 antibodies (1:250, Cell Signaling #9706) to mark G2/M-phase nuclei (Kocsisova et al., 2018). The samples were washed three times (10 minutes each) in PBST before incubation with A488-conjugated goat anti-mouse (Cat# A-11029; RRID:AB138404) and A546-conjugated goat anti-rabbit (Cat# A-11035; RRID:AB143051) (1:500 each) secondary antibodies for 1 hour at room temperature. Slides were washed three times with PBST and briefly stained with 0.7 μg/mL 4′,6-diamidino-2-phenylindole (DAPI) to visualize all nuclei. VectashieldTM mounting medium (Vector labs #H1900) was then applied, and the coverslip was sealed with nail polish. Prepared slides were stored at -20°C until they were imaged. PZ nuclei counting in 3 dimensions was partially automated using an ImageJ 1.53t plugin developed by Dr Jane Hubbard's laboratory (Korta et al., 2014) .
Differentiated germline tumour scoring
Strains were maintained at 25°C, and staged by picking GFP negative goa-1(lf); oma-1(ø); oma-2(lf) homozygote late-L4s to a new plate at 25°C. The resulting animals were imaged 48 hours later (at A2). We classified individuals as tumorous if oocyte-like germ cells filled the uterus and as non-tumorous if the uterus remained largely empty. In Fig. 1H, the vertical bars at the right represent the percentage of animals showing each of these two phenotypes, with blue indicating non-tumorous and red indicating tumorous (Clouet et al., 2025).
Statistical analysis
All bar/dot plots were generated using GraphPad Prism 10.0. For each dataset, normality was verified using the Shapiro-Wilk test, and variance equality was assessed using the Brown-Forsythe test for multi-group comparisons. Tests were chosen according to the following criteria. For multi-group comparisons where all distributions were normal and variances equal, the one-way ANOVA with Tukey's multiple comparisons was used. When distributions were non-Gaussian, the Kruskal-Wallis test with Dunn's multiple comparisons was applied instead. Tests used for each dataset are indicated in the figure legend.
","reagents":"Strain/ plasmid name | Name in text/ description | Genotype/ source material | Source/ oligo sequences (5'-> 3') |
wild-type (WT) | wild-type | Caenorhabditis Genetics Center (Brenner, 1974) | |
fog-1(ø) | GFP-negative progeny of fog-1(q785)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | Caenorhabditis Genetics Center (Morgan et al., 2010) | |
fog-1(lf) | Caenorhabditis Genetics Center (Barton & Kimble, 1990) | ||
goa-1(lf) | Caenorhabditis Genetics Center | ||
gsa-1(gf) | (Castaneda et al., 2020) | ||
GFP-negative progeny of fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | (Narbonne et al., 2015) | ||
This study | |||
sheath::GOA-1(+) | narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study; see primer info at the end of table (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | |
fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study, (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | ||
(Kumar et al., 2021) | |||
fog-1(q253)ts I, vsSi32[Pgoa-1::GOA-1::GFP + unc-119(+)] III. | This study | ||
cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | (Clouet et al., 2025) | ||
goa-1(n1134) I; cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | This study | ||
pCAM37 | LX2060 gDNA for the insert; pXA9 (derived from pGC240 (Voutev et al. 2009) for the backbone. | Insert forward: TTGGAGGGTACCGGTAGAAAAAATGGGTTGTACCATGTCACAGGA Insert reverse: AGGGGAAACAAAATGAAGAGAATTTAATACAAGCCGCATCCACGAAG Backbone forward: CTTCGTGGATGCGGCTTGTATTAAATTCTCTTCATTTTGTTTCCCCT Backbone reverse: TCCTGTGACATGGTACAACCCATTTTTTCTACCGGTACCCTCCAA
| |
E. coli | Standard E. coli bacteria used as C. elegans food | Caenorhabditis Genetics Center |
Table 1. C. elegans strains and reagents used in this study.
","patternDescription":"Stem cells must divide enough to replace cells lost to turnover and be able to increase their output in response to injuries. Yet their proliferation must also be constrained to prevent tissue overgrowth and tumorigenesis when differentiated cell turnover is reduced. This balance is achieved through homeostatic feedback loops that monitor differentiated tissue status and modulate stem/progenitor cell proliferation accordingly. At the molecular level, G protein-coupled receptor (GPCR) signalling has emerged as a key regulator of stem cell proliferation and homeostasis across diverse systems. GPCRs mediate stem cell responses to extracellular cues through heterotrimeric G proteins, with stimulatory (Gαs) and inhibitory (Gαi/o) pathways modulating stem cell division rates, self-renewal, and differentiation in multiple contexts (Kobayashi et al., 2010; Layden et al., 2010; Pedro et al., 2020). In Drosophila males for instance, germline stem cells (GSCs) increase their division frequency in response to mating-induced sperm depletion through a germ-autonomous G protein-dependent mechanism, directly demonstrating that GPCR signaling can couple stem cell output to physiological demand (Malpe et al., 2020). However, whether G protein signalling can non-autonomously contribute to tissue homeostasis has remained unclear.
The Caenorhabditis elegans germline provides a powerful in vivo system to elucidate how stem cell proliferation homeostasis is controlled. Hermaphrodites produce a finite amount of sperm during larval development before shifting irreversibly to oocyte production in adults, with oogenesis continuing at a fast pace until sperm reserves are depleted (Fig. 1A). As sperm-secreted major sperm proteins (MSPs) actively stimulate meiotic maturation and ovulation (Miller et al., 2001), once sperm reserves are depleted, arrested oocytes accumulate until a homeostatic feedback signal suppresses GSC proliferation/differentiation to stabilize a state of oocyte hyperplasia (Morgan et al., 2010; Narbonne et al., 2015, 2017; Cinquin et al., 2016; Valet & Narbonne, 2022).
The antagonistic Gαo/i GOA-1/GNAO1 and Gαs GSA-1/GNAS1 have been identified as critical regulators of MSP/ovulation signalling, where the loss of goa-1 results in spontaneous ovulation in the absence of sperm/MSPs while conversely, the loss of gsa-1 activity prevents ovulation, even in the presence of sperm/MSPs (Govindan et al., 2006, 2009). Interestingly, a goa-1 loss-of-function (lf) further impaired GSC proliferation homeostasis in feminized fog-1(ø) spermless hermaphrodites (Narbonne et al., 2015). However, and especially since the loss of goa-1 is pleiotropic, also affecting behaviour and locomotion (Ségalat et al., 1995; Mendel et al., 1995), it remained unclear if the disruption of GSC proliferation homeostasis specifically resulted from the very same role that goa-1 has in MSP signal transduction.
Germ-specific RNAi and elegant mosaic analyses unequivocally supported a requirement for goa-1 and gsa-1 in the somatic gonad for the regulation of oocyte maturation and ovulation (Govindan et al., 2006, 2009; Korswagen et al., 1997). Further, a single mosaic individual for acy-4, encoding the adenylate cyclase acting downstream of these Gα proteins, more specifically indicated a sheath cell requirement for this gene in ovulation control (Govindan et al., 2009). However, whether gsa-1 and goa-1 activities are also acting specifically within the gonadal sheath cells, rather than in another somatic gonad tissue, has remained unconfirmed.
While the gonadal sheath and spermatheca cells derive from a common somatic precursor, GSA-1 was recently implicated in the control of spermatheca contractility through a molecular cascade that overlaps with MSP signalling (Castaneda et al., 2020). Given this shared developmental origin and our recent discovery that spermatheca neck contractility was key in preventing ovulation in feminized hermaphrodites (Deng et al., 2025), we deemed it important to determine whether sheath-specific goa-1 activity was sufficient to regulate both ovulation and germline stem cell proliferation homeostasis in feminized hermaphrodites.
We first reasoned that if GOA-1 and GSA-1 have opposing activities within both MSP signalling and homeostatic GSC proliferation control, activating gsa-1 activity with a gain-of-function (gf) allele should prevent GSC downregulation in feminized hermaphrodites, like the loss of goa-1. Consistent with this, gsa-1(gf) prevented oocyte accumulation in feminized hermaphrodites and blocked the downregulation of GSC proliferation (Fig. 1B-C). To directly test the gonadal sheath requirement for goa-1, we used a standard extrachromosomal array transgene (Mello et al., 1991) to restore goa-1 specifically in this tissue within feminized goa-1(lf) mutants, using the sheath-specific lim-7 promoter (Voutev et al. 2009). As conventional N- or C-terminal tagging of Gα proteins can impair their function (Hynes et al., 2004), Kumar et al. inserted a GFP tag between residues 117-118 of GOA-1 to create a functional single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021). We used this strain as a starting point to generate a Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] extrachromosomal array, abbreviated as Plim-7::GOA-1::GFP. The resulting transgene effectively rescued both oocyte accumulation and GSC MI downregulation in fog-1(ø) goa-1(lf) hermaphrodites (Fig. 1D-F). We also examined whether sheath or spermathecae expression from a Pgoa-1::GOA-1::GFP single-copy transgene (Kumar et al., 2021) were altered by feminization, but no obvious changes were observed (Fig. 1G). Together with earlier findings (Govindan et al., 2006, 2009), our results provide strong evidence that GOA-1 acts specifically within the gonadal sheath to prevent spontaneous ovulation events in the absence of sperm/MSP to permit oocyte accumulation, and at the same time yet indirectly, to non-autonomously promote homeostatic downregulation of GSC proliferation.
Similar to the loss of GOA-1, loss of the AMPK α-catalytic subunit AAK-1 caused spontaneous ovulation and prevented homeostatic GSC downregulation in feminized hermaphrodites (Narbonne et al., 2017). The specific suppression of oocyte maturation through the inactivation of OMA-1,2 proteins (Detwiler et al., 2001) induced oocyte accumulation in aak-1(ø) mutants but did not reinstate the associated GSC downregulation, and led to the formation of differentiated germline tumours (Narbonne et al., 2017; Valet & Narbonne, 2022). We find that similarly, reduced goa-1 activity in an oma-1(ø); oma-2(lf) background provokes differentiated germline tumours (Fig. 1H). The similarity of the goa-1(lf) and aak-1(ø) phenotypes raises the intriguing possibility that aak-1 may essentially permit sheath Gα signals to suppress oocyte maturation and ovulation in the absence of sperm.
Altogether, our results reveal that the Gα GOA-1/GNAO1 ensures homeostatic GSC downregulation in spermless adult hermaphrodite C. elegans non-autonomously from the gonadal sheath cells, likely through its known roles in MSP responses and ovulation control. G-protein signalling may therefore non-autonomously regulate stem cell proliferation rates in various organisms and tissues in addition to having cell autonomous roles.
","references":[{"reference":"Brenner S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77(1), 71–94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Barton MK, Kimble J. 1990. fog-1, a regulatory gene required for specification of spermatogenesis in the germ line of Caenorhabditis elegans.. Genetics 125: 29-39.
","pubmedId":"","doi":"10.1093/genetics/125.1.29"},{"reference":"Castaneda PG, Cecchetelli AD, Pettit HN, Cram EJ. 2020. Gα/GSA-1 works upstream of PKA/KIN-1 to regulate calcium signaling and contractility in the Caenorhabditis elegans spermatheca. PLOS Genetics 16: e1008644.
","pubmedId":"","doi":"10.1371/journal.pgen.1008644"},{"reference":"Cinquin A, Chiang M, Paz A, Hallman S, Yuan O, Vysniauskaite I, Fowlkes CC, Cinquin O. 2016. Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line. PLOS Genetics 12: e1005985.
","pubmedId":"","doi":"10.1371/journal.pgen.1005985"},{"reference":"Clouet A, Valet M, Dufour B, Rieger J, Lechasseur X, Zoumabo ATrsC, et al., Narbonne. 2025. Non-autonomous PMK-1/p38 MAPK signaling ensures homeostatic downregulation of germline stem cell proliferation in\n C. elegans. : 10.1101/2025.09.24.678176.
","pubmedId":"","doi":"10.1101/2025.09.24.678176"},{"reference":"Crittenden, S. L., Leonhard, K. A., Byrd, D. T., & Kimble, J. (2006). Cellular Analyses of the Mitotic Region in the Caenorhabditis elegans Adult Germ Line. Molecular Biology of the Cell, 17, 3051–3061
","pubmedId":"","doi":"10.1091/mbc.E06"},{"reference":"Deng J, Chaudhari AM, Gagné O, Roy V, Dufour B, Martel PO, Simard MJ, Narbonne P. 2025. DAF-18/PTEN prevents oocyte wastage in spermless\n C. elegans\n hermaphrodites by blocking spermatheca neck dilation through RHO-1/RhoA disinhibition. : 10.1101/2025.09.16.676617.
","pubmedId":"","doi":"10.1101/2025.09.16.676617"},{"reference":"Detwiler MR, Reuben M, Li X, Rogers E, Lin R. 2001. Two Zinc Finger Proteins, OMA-1 and OMA-2, Are Redundantly Required for Oocyte Maturation in C. elegans. Developmental Cell 1: 187-199.
","pubmedId":"","doi":"10.1016/s1534-5807(01)00026-0"},{"reference":"Frøkjær-Jensen C, Wayne Davis M, Hopkins CE, Newman BJ, Thummel JM, Olesen SrP, Grunnet M, Jorgensen EM. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics 40: 1375-1383.
","pubmedId":"","doi":"10.1038/ng.248"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Govindan JA, Cheng H, Harris JE, Greenstein D. 2006. Gαo/i and Gαs Signaling Function in Parallel with the MSP/Eph Receptor to Control Meiotic Diapause in C. elegans. Current Biology 16: 1257-1268.
","pubmedId":"","doi":"10.1016/j.cub.2006.05.020"},{"reference":"Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D. 2009. Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation inC. elegans. Development 136: 2211-2221.
","pubmedId":"","doi":"10.1242/dev.034595"},{"reference":"Hynes TR, Hughes TE, Berlot CH. Undefined. Cellular Localization of GFP-Tagged α Subunits. G Protein Signaling : 233-246.
","pubmedId":"","doi":"10.1385/1-59259-430-1:233"},{"reference":"Kobayashi NR, Hawes SM, Crook JM, Pébay A. 2010. G-protein Coupled Receptors in Stem Cell Self-Renewal and Differentiation. Stem Cell Reviews and Reports 6: 351-366.
","pubmedId":"","doi":"10.1007/s12015-010-9167-9"},{"reference":"Kocsisova Z, Kornfeld K, Schedl T. 2018. Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans. BMC Developmental Biology 18: 10.1186/s12861-018-0171-7.
","pubmedId":"","doi":"10.1186/s12861-018-0171-7"},{"reference":"Korswagen HC, Park JH, Ohshima Y, Plasterk RH. 1997. An activating mutation in a Caenorhabditis elegans Gs protein induces neural degeneration.. Genes & Development 11: 1493-1503.
","pubmedId":"","doi":"10.1101/gad.11.12.1493"},{"reference":"Korta DZ, Tuck S, Hubbard EJA. 2012. S6K links cell fate, cell cycle and nutrient response inC. elegansgermline stem/progenitor cells. Development 139: 859-870.
","pubmedId":"","doi":"10.1242/dev.074047"},{"reference":"Kumar S, Olson AC, Koelle MR. 2021. The neural G protein Gαo tagged with GFP at an internal loop is functional in\n Caenorhabditis elegans. G3 Genes|Genomes|Genetics 11: 10.1093/g3journal/jkab167.
","pubmedId":"","doi":"10.1093/g3journal/jkab167"},{"reference":"Layden BT, Newman M, Chen F, Fisher A, Lowe WL. 2010. G Protein Coupled Receptors in Embryonic Stem Cells: A Role for Gs-Alpha Signaling. PLoS ONE 5: e9105.
","pubmedId":"","doi":"10.1371/journal.pone.0009105"},{"reference":"Lee MH, Ohmachi M, Arur S, Nayak S, Francis R, Church D, Lambie E, Schedl T. 2007. Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling inCaenorhabditis elegansGermline Development. Genetics 177: 2039-2062.
","pubmedId":"","doi":"10.1534/genetics.107.081356"},{"reference":"Malpe MS, McSwain LF, Kudyba K, Ng CL, Nicholson J, Brady M, et al., Schulz. 2020. G-protein signaling is required for increasing germline stem cell division frequency in response to mating in Drosophila males. Scientific Reports 10: 10.1038/s41598-020-60807-8.
","pubmedId":"","doi":"10.1038/s41598-020-60807-8"},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences.. The EMBO Journal 10: 3959-3970.
","pubmedId":"","doi":"10.1002/j.1460-2075.1991.tb04966.x"},{"reference":"Mendel JE, Korswagen HC, Liu KS, Hajdu-Cronin YM, Simon MI, Plasterk RHA, Sternberg PW. 1995. Participation of the Protein G\n o\n in Multiple Aspects of Behavior in\n C. elegans. Science 267: 1652-1655.
","pubmedId":"","doi":"10.1126/science.7886455"},{"reference":"Miller MA, Nguyen VQ, Lee MH, Kosinski M, Schedl T, Caprioli RM, Greenstein D. 2001. A Sperm Cytoskeletal Protein That Signals Oocyte Meiotic Maturation and Ovulation. Science 291: 2144-2147.
","pubmedId":"","doi":"10.1126/science.1057586"},{"reference":"Morgan DE, Crittenden SL, Kimble J. 2010. The C. elegans adult male germline: Stem cells and sexual dimorphism. Developmental Biology 346: 204-214.
","pubmedId":"","doi":"10.1016/j.ydbio.2010.07.022"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2015. daf-18/PTEN locally antagonizes insulin signalling to couple germline stem cell proliferation to oocyte needs inC. elegans. Development : 10.1242/dev.130252.
","pubmedId":"","doi":"10.1242/dev.130252"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2017. DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation. PLOS Genetics 13: e1006738.
","pubmedId":"","doi":"10.1371/journal.pgen.1006738"},{"reference":"Pedro MP, Lund K, Iglesias-Bartolome R. 2020. The landscape of GPCR signaling in the regulation of epidermal stem cell fate and skin homeostasis. Stem Cells 38: 1520-1531.
","pubmedId":"","doi":"10.1002/stem.3273"},{"reference":"Robinson-Thiewes S, Dufour B, Martel PO, Lechasseur X, Brou AAD, Roy V, et al., Narbonne. 2021. Non-autonomous regulation of germline stem cell proliferation by somatic MPK-1/MAPK activity in C. elegans. Cell Reports 35: 109162.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109162"},{"reference":"Ségalat L, Elkes DA, Kaplan JM. 1995. Modulation of Serotonin-Controlled Behaviors by G\n o\n in\n Caenorhabditis elegans. Science 267: 1648-1651.
","pubmedId":"","doi":"10.1126/science.7886454"},{"reference":"Seydoux G, Salvage C, Greenwald I. 1993. Isolation and Characterization of Mutations Causing Abnormal Eversion of the Vulva in Caenorhabditis elegans. Developmental Biology 157: 423-436.
","pubmedId":"","doi":"10.1006/DBIO.1993.1146"},{"reference":"Valet M, Narbonne P. 2022. Formation of benign tumors by stem cell deregulation. PLOS Genetics 18: e1010434.
","pubmedId":"","doi":"10.1371/journal.pgen.1010434"},{"reference":"Voutev R, Keating R, Jane Albert Hubbard E, Vallier LG. 2008. Characterization of the\n Caenorhabditis elegans\n Islet\n LIM‐homeodomain ortholog,\n lim‐7. FEBS Letters 583: 456-464.
","pubmedId":"","doi":"10.1016/j.febslet.2008.12.046"}],"title":"The Gα GOA-1/GNAO1 non-autonomously promotes germline stem cell quiescence in feminized C. elegans hermaphrodites from the gonadal sheath cells
","reviews":[{"reviewer":{"displayName":"Erin Cram"},"openAcknowledgement":true,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"e45419ea-77f3-409b-89a4-5ecc9d8a4d5f","decision":"accept","abstract":"Stem cell proliferation rates must be precisely regulated as insufficient proliferation leads to tissue loss, whereas excessive proliferation causes tumorigenesis and cancer. A homeostatic balance is therefore achieved through feedback loops that adjust stem/progenitor cell proliferation rates to match the demand for their differentiated progeny. While such a homeostatic feedback mechanism adjusts germline stem cell (GSC) proliferation rates to oocyte needs in the Caenorhabditis elegans adult hermaphrodite germline, its inner workings are incompletely understood. Here we show that the Gα GOA-1/GNAO1 is required specifically in the gonadal sheath cells to non-autonomously promote GSC quiescence in spermless hermaphrodites. Given that dysregulation of G protein signalling is frequently observed in human cancers, Gα dependent homeostatic control of stem cell proliferation may represent a conserved tumour suppressive mechanism.
","acknowledgements":"We thank the Caenorhabditis Genetics Center (CGC) for providing strains and WormBase for curating and maintaining the genomic and phenotypic data used in this study.
","authors":[{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["writing_originalDraft","conceptualization","dataCuration","formalAnalysis","methodology","validation"],"email":"armichaudhary97@gmail.com","firstName":"Armi M","lastName":"Chaudhari","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7908-2157"},{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["methodology"],"email":"thuminhnguyen1909@gmail.com","firstName":"Minh Thu ","lastName":"Nguyen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale",""],"credit":["conceptualization","fundingAcquisition","investigation","project","resources","supervision","validation","writing_reviewEditing","formalAnalysis"],"email":"patrick.narbonne@uqtr.ca","firstName":"Patrick","lastName":"Narbonne","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Research in the Narbonne Laboratory is funded by grants awarded to PN from the Fondation Marcel & Rolande Gosselin, the Natural Sciences and Engineering Research Council of Canada (RGPIN-2026-05498), the Fonds de recherche du Québec – Santé (310643) and the Canadian Institutes of Health Research (PJT-169138). AC is financially supported by a PBEEE scholarship (332795) and a doctoral scholarship from the Fonds de recherche du Québec – Santé (367752). MTN was supported by the Canada-Asean Scholarship and Educational Exchanges for Development (SEED) program.
","image":{"url":"https://portal.micropublication.org/uploads/4e25f4b8152ac575546bc3d8e8c6ba78.jpg"},"imageCaption":"(A) Model for homeostatic regulation of germline stem/progenitor cell (GSC) proliferation rates in adult C. elegans hermaphrodites. GSCs located in the distal progenitor zone (PZ) generate daughters that, upon exiting the niche, differentiate into oocytes. Major sperm proteins (MSPs) released by sperm stimulate oocyte maturation and ovulation via G-protein coupled receptors and cAMP signalling in the gonadal sheath cells (Govindan et al., 2006, 2009) to establish oocyte demand. A strong oocyte demand in turn promotes MPK-1/ERK-dependent GSC proliferation (Lee et al., 2007; Narbonne et al., 2017; Robinson-Thiewes et al., 2021). (B-E) The number of (B, D) oocytes in diakinesis per gonad arm and (C, E) the GSC mitotic index of day-1 adult (A1) hermaphrodites of the indicated genotypes were scored. Each bar represents the mean ± standard deviation, and each point represent the value from a single gonad arm; one or both arms per individual were scored. Triple asterisks indicate statistical significance vs the wild-type (P<0.001). Statistical analyses used a one-way ANOVA followed by Tukey's multiple comparisons for (B, D) and the Kruskal–Wallis test followed by Dunn's multiple comparisons for (C, E). ns, not significant. (F) Representative differential interference contrast (DIC) micrographs of proximal gonads of A1 hermaphrodites of the indicated genotypes. The bottom panel shows the epifluorescence signal from the sheath-expressed Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] (abbreviated as Plim-7::GOA-1::GFP) construct as a green overlay. (G) The sheath and spermathecal (Sp) expression pattern and levels from the single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021) were similar in A1 (top) control and (bottom) feminized fog-1(lf) mutants. (H) The (top) oma-1(ø); oma-2(lf) (n=18) double mutants usually maintain a state of relatively stable oocyte hyperplasia beyond A2 while all the (bottom) goa-1(lf); oma-1(ø); oma-2(lf) (n=22) triples have hyperaccumulated oocytes by then. A tumour penetrance percentage is shown as a coloured vertical bar on the right (blue, stable hyperplasia; red, oocytes hyperaccumulation/differentiated tumour). (I) Example of a younger tumorous goa-1(lf); oma-1(ø); oma-2(lf) mutant, slightly after it progressed beyond hyperplasia and clearly started to hyperaccumulate large oocyte-like differentiated germ cells. (F-I) Yellow dotted lines mark the region occupied by oocyte-like cells. Scale bars, 50 μm. (H-I) All strains contain cpSi42[Pmex-5::mNG::PLCδ-PH::tbb-2 3'UTR + unc-119(+)], marking germ membranes with green fluorescence. (B-H) Alleles, gsa-1(ce94)gf, fog-1(q253)ts, fog-1(q785)ø, goa-1(n1134)lf, vsSi32[goa-1::GFP + unc-119(+)], narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry], oma-1(zu405te33)ø, oma-2(te51)lf.
","imageTitle":"GOA-1 suppresses GSC proliferation from the gonadal sheath cells
","methods":"C. elegans strains and maintenance
C. elegans strains were maintained at 15oC on standard nematode growth medium (NGM) seeded with E. coli (OP50) unless otherwise indicated. The Bristol (N2) isolate served as wild-type throughout (Brenner, 1974). Table 1 provides a complete list of the C. elegans strains and reagents used in this work.
Plasmid and transgenic strain
We used the Gibson method (Gibson et al., 2009) for plasmid assembly; primers are listed in Table 1. To achieve sheath-specific goa-1 rescue, the LX2060 strain carrying a single-copy insertion of a GOA-1::GFP translational fusion driven by 5 kb of goa-1 promoter (Kumar et al., 2021) was used to amplify the goa-1 N-term::GFP::goa-1 C-term genomic sequence (~4.5 kb). The resulting fragment was inserted downstream of the lim-7 promoter in a vector derived from pGC240 (Voutev et al., 2009). The integrity of the resulting pCAM37 plasmid was confirmed by XbaI restriction digestion. The microinjection mix consisted of three plasmids: pCAM37 at 50 ng/µL, pCFJ104 at 5 ng/µL (Frøkjær-Jensen et al., 2008) and pKSII as carrier DNA at 150 ng/µL. The mixture was microinjected into the germline syncytium of wild-type hermaphrodites (Mello et al., 1991) to establish and select an array that was subsequently crossed into the fog-1(ø) goa-1(lf) double mutant strain for assaying its rescuing activity.
Imaging and image processing
All hermaphrodites used for imaging or scoring were synchronized by picking late-L4 stage larvae, based on vulva development (Seydoux et al., 1993), to a new plate that was upshifted to 25 °C for an additional 24 hours to generate day-1 adults (referred to as A1) (Narbonne et al., 2015, 2017; Robinson-Thiewes et al., 2021) or 48 hours for A2. For live imaging, the resulting hermaphrodites were immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad.
Differential interference contrast (DIC) and epifluorescence images were acquired at 1 µm z-intervals using a Plan-Apochromat 20× dry objective (NA 0.8) mounted on an inverted Zeiss Axio Observer.Z1 microscope. For epifluorescence (Fig. 1G-H), samples were excited by a LED module at 488 nm (50% intensity, 100 ms exposure) and emission was collected at 500–550 nm. Stitching and deconvolution were performed using the Zen 3.8 software. For the high-resolution confocal fluorescence acquisition shown as a pseudo-DIC overlay in Fig. 1F (the Plim-7::GOA-1::GFP rescue image), coverslips were sealed with VALAP (1:1:1 Vaseline, lanolin, paraffin), and a single focal plane was acquired using a Leica Microsystems Stellaris 5 confocal microscope equipped with an HC PL APO CS2 63×/1.30 numerical aperture oil immersion objective. Samples were excited by a 488 nm laser (5% intensity) and emission was collected at 507–528 nm with a pinhole setting of 1. Specimens were digitally straightened using ImageJ.
Arrested oocyte quantification
For fog-1(lf), late-L4 hermaphrodites were upshifted from 15 °C to 25 °C and maintained at this temperature along with their F1 progeny for 3 days to prevent spermatogenesis (Barton & Kimble, 1990). The resulting late-L4 feminized F1 hermaphrodites were transferred onto fresh plates at 25 °C based on vulval morphology (Seydoux et al., 1993) and allowed to develop for another 24 hours to obtain A1. For the fog-1(ø) goa-1(lf) strain, non-fluorescent late-L4 hermaphrodites were picked from asynchronous cultures at 15 °C onto fresh plates at 25 °C. In both cases, the resulting feminized A1 were collected, immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad. Oocyte number per gonad arm was quantified by DIC microscopy by counting morphologically distinct diakinesis-stage oocytes extending distally from the spermatheca.
GSC mitotic index
The progenitor zone (PZ)/GSC mitotic index (MI) was assessed following a previously established protocol (Crittenden et al., 2006; Robinson-Thiewes et al., 2021). In brief, A1 hermaphrodites prepared as above were picked into a drop of 1X PBS placed on a coverslip and rapidly dissected using a surgical needle. The coverslip was then flipped onto a poly-L-lysine-coated slide and subjected to a standard -80 °C freeze-crack procedure. Samples were subsequently fixed in -20 °C methanol for 1 minute and post-fixed in a 3.7% paraformaldehyde solution (3.7% paraformaldehyde, 1X PBS, 0.08 M HEPES, 1.6 mM MgSO4, 0.8 mM EGTA, pH 7.4) for 30 minutes. After fixation, gonads were washed twice (10 minutes each) in PBST (PBS + 0.1% Tween 20) and then blocked in PBST + 3% BSA for 1 hour at room temperature. Primary antibody staining was performed overnight at 4 °C using polyclonal rabbit anti-WAPL-1 (1:500, Sdix #4930.00.02) to label GSCs and their proliferative progeny, along with mouse monoclonal anti-phospho[Ser10]-histone H3 antibodies (1:250, Cell Signaling #9706) to mark G2/M-phase nuclei (Kocsisova et al., 2018). The samples were washed three times (10 minutes each) in PBST before incubation with A488-conjugated goat anti-mouse (Cat# A-11029; RRID:AB138404) and A546-conjugated goat anti-rabbit (Cat# A-11035; RRID:AB143051) (1:500 each) secondary antibodies for 1 hour at room temperature. Slides were washed three times with PBST and briefly stained with 0.7 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) to visualize all nuclei. Vectashield™ mounting medium (Vector labs #H1900) was then applied, and the coverslip was sealed with nail polish. Prepared slides were stored at -20 °C until they were imaged. PZ nuclei counting in 3 dimensions was partially automated using an ImageJ plugin developed by Dr Jane Hubbard's laboratory (Korta et al., 2014).
Differentiated germline tumour scoring
Strains were maintained at 25 °C, and staged by picking GFP negative goa-1(lf); oma-1(ø); oma-2(lf) homozygote late-L4s to a new plate at 25 °C. The resulting animals were imaged 48 hours later (at A2). We classified individuals as tumorous if they contained obviously more oocyte-like cells than same-age stable hyperplastic oma-1(ø); oma-2(lf) controls (Clouet et al., 2025). Disorganized oocyte-like cells usually fill the uterus of tumorous animals but not of controls, facilitating the scoring of this phenotype.
Statistical analysis
All bar/dot plots were generated using GraphPad Prism 10.0. For each dataset, normality was verified using the Shapiro-Wilk test, and variance equality was assessed using the Brown-Forsythe test for multi-group comparisons. Tests were chosen according to the following criteria. For multi-group comparisons where all distributions were normal and variances equal, the one-way ANOVA with Tukey's multiple comparisons was used. When distributions were non-Gaussian, the Kruskal-Wallis test with Dunn's multiple comparisons was applied instead. Tests used for each dataset are indicated in the figure legend.
","reagents":"Strain/ plasmid name | Name in text/ description | Genotype/ source material | Source/ oligo sequences (5'-> 3') |
wild-type (WT) | wild-type | Caenorhabditis Genetics Center (Brenner, 1974) | |
fog-1(ø) | GFP-negative progeny of fog-1(q785)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | Caenorhabditis Genetics Center (Morgan et al., 2010) | |
fog-1(lf) | Caenorhabditis Genetics Center (Barton & Kimble, 1990) | ||
goa-1(lf) | Caenorhabditis Genetics Center | ||
gsa-1(gf) | (Castaneda et al., 2020) | ||
GFP-negative progeny of fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | (Narbonne et al., 2015) | ||
This study | |||
sheath::GOA-1(+) | narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study; see primer info at the end of table (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | |
fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study, (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | ||
(Kumar et al., 2021) | |||
fog-1(q253)ts I, vsSi32[Pgoa-1::GOA-1::GFP + unc-119(+)] III. | This study | ||
cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | (Clouet et al., 2025) | ||
goa-1(n1134) I; cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | This study | ||
pCAM37 | LX2060 gDNA for the insert; pXA9 (derived from pGC240 (Voutev et al. 2009) for the backbone. | Insert forward: TTGGAGGGTACCGGTAGAAAAAATGGGTTGTACCATGTCACAGGA Insert reverse: AGGGGAAACAAAATGAAGAGAATTTAATACAAGCCGCATCCACGAAG Backbone forward: CTTCGTGGATGCGGCTTGTATTAAATTCTCTTCATTTTGTTTCCCCT Backbone reverse: TCCTGTGACATGGTACAACCCATTTTTTCTACCGGTACCCTCCAA
| |
E. coli | Standard E. coli bacteria used as C. elegans food | Caenorhabditis Genetics Center |
Table 1. C. elegans strains and reagents used in this study.
","patternDescription":"Stem cells must divide often enough to replace cells lost to turnover and be able to increase their output in response to injuries. Yet their proliferation must also be constrained to prevent tissue overgrowth and tumorigenesis when differentiated cell turnover is reduced. This balance is achieved through homeostatic feedback loops that monitor differentiated tissue status and modulate stem/progenitor cell proliferation accordingly. At the molecular level, G protein-coupled receptor (GPCR) signalling has emerged as a key regulator of stem cell proliferation and homeostasis across diverse systems. GPCRs mediate stem cell responses to extracellular cues through heterotrimeric G proteins, with stimulatory (Gαs) and inhibitory (Gαi/o) pathways modulating stem cell division rates, self-renewal, and differentiation in multiple contexts (Kobayashi et al., 2010; Layden et al., 2010; Pedro et al., 2020). In Drosophila males for instance, germline stem cells (GSCs) increase their division frequency in response to mating-induced sperm depletion through a germ-autonomous G protein-dependent mechanism, directly demonstrating that GPCR signaling can couple stem cell output to physiological demand (Malpe et al., 2020). However, whether G protein signalling can non-autonomously contribute to tissue homeostasis has remained unclear.
The Caenorhabditis elegans germline provides a powerful in vivo system to elucidate how stem cell proliferation homeostasis is controlled. Hermaphrodites produce a finite number of sperm during larval development before shifting irreversibly to oocyte production in adults, with oogenesis continuing at a fast pace until sperm reserves are depleted (Fig. 1A). As sperm-secreted major sperm proteins (MSPs) actively stimulate meiotic maturation and ovulation (Miller et al., 2001), once sperm reserves are depleted, arrested oocytes accumulate until a homeostatic feedback signal suppresses GSC proliferation/differentiation to stabilize a state of oocyte hyperplasia (Morgan et al., 2010; Narbonne et al., 2015, 2017; Cinquin et al., 2016; Valet & Narbonne, 2022).
The antagonistic inhibitory Gαo/i GOA-1/GNAO1 and stimulatory Gαs GSA-1/GNAS1 have been identified as critical regulators of MSP/ovulation signalling, where the loss of goa-1 results in spontaneous ovulation in the absence of sperm/MSPs while conversely, the loss of gsa-1 activity prevents ovulation, even in the presence of sperm/MSPs (Govindan et al., 2006, 2009). Interestingly, a goa-1 loss-of-function (lf) further impaired GSC proliferation homeostasis in feminized fog-1(ø) spermless hermaphrodites (Narbonne et al., 2015). However, and especially since the loss of goa-1 is pleiotropic, also affecting behaviour and locomotion (Ségalat et al., 1995; Mendel et al., 1995), it remained unclear if the disruption of GSC proliferation homeostasis specifically resulted from the very same role that goa-1 has in MSP signal transduction.
Germ-specific RNAi and elegant mosaic analyses unequivocally supported a requirement for goa-1 and gsa-1 in the somatic gonad for the regulation of oocyte maturation and ovulation (Govindan et al., 2006, 2009; Korswagen et al., 1997). Further, a single mosaic individual for acy-4, encoding the adenylate cyclase acting downstream of these Gα proteins, more specifically indicated a sheath cell requirement for this gene in ovulation control (Govindan et al., 2009). However, whether gsa-1 and goa-1 activities are also acting specifically within the gonadal sheath cells, rather than in another somatic gonad tissue, has remained unconfirmed.
While the gonadal sheath and spermathecal cells derive from a common somatic precursor, GSA-1 was recently implicated in the control of spermathecal contractility through a molecular cascade that overlaps with MSP signalling (Castaneda et al., 2020). Given this shared developmental origin and our recent discovery that spermathecal neck contractility was key in preventing ovulation in feminized hermaphrodites (Deng et al., 2025), we deemed it important to determine whether sheath-specific goa-1 activity was sufficient to regulate both ovulation and germline stem cell proliferation homeostasis in feminized hermaphrodites.
We first reasoned that if GOA-1 and GSA-1 have opposing activities within both MSP signalling and homeostatic GSC proliferation control, activating gsa-1 with a gain-of-function (gf) allele should prevent GSC downregulation in feminized hermaphrodites, like the loss of goa-1. Consistent with this, gsa-1(gf) prevented oocyte accumulation in feminized hermaphrodites and blocked the downregulation of GSC proliferation (Fig. 1B-C). To directly test the gonadal sheath requirement for goa-1, we used a standard extrachromosomal array transgene (Mello et al., 1991) to restore goa-1 specifically in this tissue within feminized goa-1(lf) mutants, using the sheath-specific lim-7 promoter (Voutev et al., 2009). As conventional N- or C-terminal tagging of Gα proteins can impair their function (Hynes et al., 2004), Kumar et al. inserted a GFP tag between residues 117-118 of GOA-1 to create a functional single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021). We used this strain as a starting point to generate a Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] extrachromosomal array, abbreviated as Plim-7::GOA-1::GFP. The resulting transgene effectively rescued both oocyte accumulation and GSC MI downregulation in fog-1(ø) goa-1(lf) hermaphrodites (Fig. 1D-F). We also examined whether sheath or spermathecal expression from a Pgoa-1::GOA-1::GFP single-copy transgene (Kumar et al., 2021) were altered by feminization, but no obvious changes were observed (Fig. 1G). Together with earlier findings (Govindan et al., 2006, 2009), our results provide strong evidence that GOA-1 acts specifically within the gonadal sheath to prevent spontaneous ovulation events in the absence of sperm/MSP to permit oocyte accumulation, and at the same time yet indirectly, to non-autonomously promote homeostatic downregulation of GSC proliferation.
Similar to the loss of GOA-1, loss of the AMPK α-catalytic subunit AAK-1 caused spontaneous ovulation and prevented homeostatic GSC downregulation in feminized hermaphrodites (Narbonne et al., 2017). The specific suppression of oocyte maturation through the inactivation of OMA-1,2 proteins (Detwiler et al., 2001) restored oocyte accumulation in aak-1(ø) mutants but failed to reinstate homeostatic GSC downregulation, resulting in the formation of benign differentiated germline tumours akin to hamartomas, in which differentiated oocyte-like cells hyperaccumulate in a disorganized manner as a consequence of homeostatically unchecked GSC proliferation (Ali & Mulita, 2023; Narbonne et al., 2017; Valet & Narbonne, 2022). We find that likewise, reduced goa-1 activity in an oma-1(ø); oma-2(lf) background provokes a hyperaccumulation of oocyte-like cells (Fig. 1H-I). The similarity of the goa-1(lf) and aak-1(ø) phenotypes raises the intriguing possibility that aak-1 may essentially permit sheath Gα signals to suppress oocyte maturation and ovulation in the absence of sperm.
Altogether, our results reveal that the stimulatory Gα GOA-1/GNAO1 ensures homeostatic GSC downregulation in spermless adult hermaphrodite C. elegans non-autonomously from the gonadal sheath cells, likely through its known roles in MSP responses and ovulation control. G-protein signalling may therefore non-autonomously regulate stem cell proliferation rates in various organisms and tissues in addition to having cell autonomous roles.
","references":[{"reference":"Ali SA, Mulita F. 2026. Hamartoma. StatPearls Publishing.
","pubmedId":"32965969","doi":""},{"reference":"Brenner S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77(1), 71–94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Barton MK, Kimble J. 1990. fog-1, a regulatory gene required for specification of spermatogenesis in the germ line of Caenorhabditis elegans.. Genetics 125: 29-39.
","pubmedId":"","doi":"10.1093/genetics/125.1.29"},{"reference":"Castaneda PG, Cecchetelli AD, Pettit HN, Cram EJ. 2020. Gα/GSA-1 works upstream of PKA/KIN-1 to regulate calcium signaling and contractility in the Caenorhabditis elegans spermatheca. PLOS Genetics 16: e1008644.
","pubmedId":"","doi":"10.1371/journal.pgen.1008644"},{"reference":"Cinquin A, Chiang M, Paz A, Hallman S, Yuan O, Vysniauskaite I, Fowlkes CC, Cinquin O. 2016. Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line. PLOS Genetics 12: e1005985.
","pubmedId":"","doi":"10.1371/journal.pgen.1005985"},{"reference":"Clouet A, Valet M, Dufour B, Rieger J, Lechasseur X, Zoumabo ATrsC, et al., Narbonne. 2025. Non-autonomous PMK-1/p38 MAPK signaling ensures homeostatic downregulation of germline stem cell proliferation in\n C. elegans. : 10.1101/2025.09.24.678176.
","pubmedId":"","doi":"10.1101/2025.09.24.678176"},{"reference":"Crittenden, S. L., Leonhard, K. A., Byrd, D. T., & Kimble, J. (2006). Cellular Analyses of the Mitotic Region in the Caenorhabditis elegans Adult Germ Line. Molecular Biology of the Cell, 17, 3051–3061
","pubmedId":"","doi":"10.1091/mbc.E06"},{"reference":"Deng J, Chaudhari AM, Gagné O, Roy V, Dufour B, Martel PO, Simard MJ, Narbonne P. 2025. DAF-18/PTEN prevents oocyte wastage in spermless\n C. elegans\n hermaphrodites by blocking spermatheca neck dilation through RHO-1/RhoA disinhibition. : 10.1101/2025.09.16.676617.
","pubmedId":"","doi":"10.1101/2025.09.16.676617"},{"reference":"Detwiler MR, Reuben M, Li X, Rogers E, Lin R. 2001. Two Zinc Finger Proteins, OMA-1 and OMA-2, Are Redundantly Required for Oocyte Maturation in C. elegans. Developmental Cell 1: 187-199.
","pubmedId":"","doi":"10.1016/s1534-5807(01)00026-0"},{"reference":"Frøkjær-Jensen C, Wayne Davis M, Hopkins CE, Newman BJ, Thummel JM, Olesen SrP, Grunnet M, Jorgensen EM. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics 40: 1375-1383.
","pubmedId":"","doi":"10.1038/ng.248"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Govindan JA, Cheng H, Harris JE, Greenstein D. 2006. Gαo/i and Gαs Signaling Function in Parallel with the MSP/Eph Receptor to Control Meiotic Diapause in C. elegans. Current Biology 16: 1257-1268.
","pubmedId":"","doi":"10.1016/j.cub.2006.05.020"},{"reference":"Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D. 2009. Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation inC. elegans. Development 136: 2211-2221.
","pubmedId":"","doi":"10.1242/dev.034595"},{"reference":"Hynes TR, Hughes TE, Berlot CH. Undefined. Cellular Localization of GFP-Tagged α Subunits. G Protein Signaling : 233-246.
","pubmedId":"","doi":"10.1385/1-59259-430-1:233"},{"reference":"Kobayashi NR, Hawes SM, Crook JM, Pébay A. 2010. G-protein Coupled Receptors in Stem Cell Self-Renewal and Differentiation. Stem Cell Reviews and Reports 6: 351-366.
","pubmedId":"","doi":"10.1007/s12015-010-9167-9"},{"reference":"Kocsisova Z, Kornfeld K, Schedl T. 2018. Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans. BMC Developmental Biology 18: 10.1186/s12861-018-0171-7.
","pubmedId":"","doi":"10.1186/s12861-018-0171-7"},{"reference":"Korswagen HC, Park JH, Ohshima Y, Plasterk RH. 1997. An activating mutation in a Caenorhabditis elegans Gs protein induces neural degeneration.. Genes & Development 11: 1493-1503.
","pubmedId":"","doi":"10.1101/gad.11.12.1493"},{"reference":"Korta DZ, Tuck S, Hubbard EJA. 2012. S6K links cell fate, cell cycle and nutrient response inC. elegansgermline stem/progenitor cells. Development 139: 859-870.
","pubmedId":"","doi":"10.1242/dev.074047"},{"reference":"Kumar S, Olson AC, Koelle MR. 2021. The neural G protein Gαo tagged with GFP at an internal loop is functional in\n Caenorhabditis elegans. G3 Genes|Genomes|Genetics 11: 10.1093/g3journal/jkab167.
","pubmedId":"","doi":"10.1093/g3journal/jkab167"},{"reference":"Layden BT, Newman M, Chen F, Fisher A, Lowe WL. 2010. G Protein Coupled Receptors in Embryonic Stem Cells: A Role for Gs-Alpha Signaling. PLoS ONE 5: e9105.
","pubmedId":"","doi":"10.1371/journal.pone.0009105"},{"reference":"Lee MH, Ohmachi M, Arur S, Nayak S, Francis R, Church D, Lambie E, Schedl T. 2007. Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling inCaenorhabditis elegansGermline Development. Genetics 177: 2039-2062.
","pubmedId":"","doi":"10.1534/genetics.107.081356"},{"reference":"Malpe MS, McSwain LF, Kudyba K, Ng CL, Nicholson J, Brady M, et al., Schulz. 2020. G-protein signaling is required for increasing germline stem cell division frequency in response to mating in Drosophila males. Scientific Reports 10: 10.1038/s41598-020-60807-8.
","pubmedId":"","doi":"10.1038/s41598-020-60807-8"},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences.. The EMBO Journal 10: 3959-3970.
","pubmedId":"","doi":"10.1002/j.1460-2075.1991.tb04966.x"},{"reference":"Mendel JE, Korswagen HC, Liu KS, Hajdu-Cronin YM, Simon MI, Plasterk RHA, Sternberg PW. 1995. Participation of the Protein G\n o\n in Multiple Aspects of Behavior in\n C. elegans. Science 267: 1652-1655.
","pubmedId":"","doi":"10.1126/science.7886455"},{"reference":"Miller MA, Nguyen VQ, Lee MH, Kosinski M, Schedl T, Caprioli RM, Greenstein D. 2001. A Sperm Cytoskeletal Protein That Signals Oocyte Meiotic Maturation and Ovulation. Science 291: 2144-2147.
","pubmedId":"","doi":"10.1126/science.1057586"},{"reference":"Morgan DE, Crittenden SL, Kimble J. 2010. The C. elegans adult male germline: Stem cells and sexual dimorphism. Developmental Biology 346: 204-214.
","pubmedId":"","doi":"10.1016/j.ydbio.2010.07.022"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2015. daf-18/PTEN locally antagonizes insulin signalling to couple germline stem cell proliferation to oocyte needs inC. elegans. Development : 10.1242/dev.130252.
","pubmedId":"","doi":"10.1242/dev.130252"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2017. DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation. PLOS Genetics 13: e1006738.
","pubmedId":"","doi":"10.1371/journal.pgen.1006738"},{"reference":"Pedro MP, Lund K, Iglesias-Bartolome R. 2020. The landscape of GPCR signaling in the regulation of epidermal stem cell fate and skin homeostasis. Stem Cells 38: 1520-1531.
","pubmedId":"","doi":"10.1002/stem.3273"},{"reference":"Robinson-Thiewes S, Dufour B, Martel PO, Lechasseur X, Brou AAD, Roy V, et al., Narbonne. 2021. Non-autonomous regulation of germline stem cell proliferation by somatic MPK-1/MAPK activity in C. elegans. Cell Reports 35: 109162.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109162"},{"reference":"Ségalat L, Elkes DA, Kaplan JM. 1995. Modulation of Serotonin-Controlled Behaviors by G\n o\n in\n Caenorhabditis elegans. Science 267: 1648-1651.
","pubmedId":"","doi":"10.1126/science.7886454"},{"reference":"Seydoux G, Salvage C, Greenwald I. 1993. Isolation and Characterization of Mutations Causing Abnormal Eversion of the Vulva in Caenorhabditis elegans. Developmental Biology 157: 423-436.
","pubmedId":"","doi":"10.1006/DBIO.1993.1146"},{"reference":"Valet M, Narbonne P. 2022. Formation of benign tumors by stem cell deregulation. PLOS Genetics 18: e1010434.
","pubmedId":"","doi":"10.1371/journal.pgen.1010434"},{"reference":"Voutev R, Keating R, Jane Albert Hubbard E, Vallier LG. 2008. Characterization of the\n Caenorhabditis elegans\n Islet\n LIM‐homeodomain ortholog,\n lim‐7. FEBS Letters 583: 456-464.
","pubmedId":"","doi":"10.1016/j.febslet.2008.12.046"}],"title":"The Gα GOA-1/GNAO1 non-autonomously promotes germline stem cell quiescence in feminized C. elegans hermaphrodites from the gonadal sheath cells
","reviews":[{"reviewer":{"displayName":"Erin Cram"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1786489870440"}]},{"id":"291bc369-a7b1-4d6e-a682-94c3241eb6b1","decision":"accept","abstract":"Stem cell proliferation rates must be precisely regulated as insufficient proliferation leads to tissue loss, whereas excessive proliferation causes tumorigenesis and cancer. A homeostatic balance is therefore achieved through feedback loops that adjust stem/progenitor cell proliferation rates to match the demand for their differentiated progeny. While such a homeostatic feedback mechanism adjusts germline stem cell (GSC) proliferation rates to oocyte needs in the Caenorhabditis elegans adult hermaphrodite germline, its inner workings are incompletely understood. Here we show that the Gα GOA-1/GNAO1 is required specifically in the gonadal sheath cells to non-autonomously promote GSC quiescence in spermless hermaphrodites. Given that dysregulation of G protein signalling is frequently observed in human cancers, Gα dependent homeostatic control of stem cell proliferation may represent a conserved tumour suppressive mechanism.
","acknowledgements":"We thank the Caenorhabditis Genetics Center (CGC) for providing strains and WormBase for curating and maintaining the genomic and phenotypic data used in this study.
","authors":[{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["writing_originalDraft","conceptualization","dataCuration","formalAnalysis","methodology","validation"],"email":"armichaudhary97@gmail.com","firstName":"Armi M","lastName":"Chaudhari","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7908-2157"},{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["methodology"],"email":"thuminhnguyen1909@gmail.com","firstName":"Minh Thu ","lastName":"Nguyen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Quebec at Trois-Rivieres, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale",""],"credit":["conceptualization","fundingAcquisition","investigation","project","resources","supervision","validation","writing_reviewEditing","formalAnalysis"],"email":"patrick.narbonne@uqtr.ca","firstName":"Patrick","lastName":"Narbonne","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Research in the Narbonne Laboratory is funded by grants awarded to PN from the Fondation Marcel & Rolande Gosselin, the Natural Sciences and Engineering Research Council of Canada (RGPIN-2026-05498), the Fonds de recherche du Québec – Santé (310643) and the Canadian Institutes of Health Research (PJT-169138). AC is financially supported by a PBEEE scholarship (332795) and a doctoral scholarship from the Fonds de recherche du Québec – Santé (367752). MTN was supported by the Canada-ASEAN Scholarship and Educational Exchanges for Development (SEED) program.
","image":{"url":"https://portal.micropublication.org/uploads/15097193bb263ad949577d8db41fa718.jpg"},"imageCaption":"(A) Model for homeostatic regulation of germline stem/progenitor cell (GSC) proliferation rates in adult C. elegans hermaphrodites. GSCs located in the distal progenitor zone (PZ) generate daughters that, upon exiting the niche, differentiate into oocytes. Major sperm proteins (MSPs) released by sperm stimulate oocyte maturation and ovulation via G-protein coupled receptors and cAMP signalling in the gonadal sheath cells (Govindan et al., 2006, 2009) to establish oocyte demand. A strong oocyte demand in turn promotes MPK-1/ERK-dependent GSC proliferation (Lee et al., 2007; Narbonne et al., 2017; Robinson-Thiewes et al., 2021). (B-E) The number of (B, D) oocytes in diakinesis per gonad arm and (C, E) the GSC mitotic index of day-1 adult (A1) hermaphrodites of the indicated genotypes were scored. Each bar represents the mean ± standard deviation, and each point represents the value from a single gonad arm; one or both arms per individual were scored. Triple asterisks indicate statistical significance vs the wild-type (P<0.001). Statistical analyses used a one-way ANOVA followed by Tukey's multiple comparisons for (B, D) and the Kruskal–Wallis test followed by Dunn's multiple comparisons for (C, E). ns, not significant. (F) Representative differential interference contrast (DIC) micrographs of proximal gonads of A1 hermaphrodites of the indicated genotypes. The bottom panel shows the epifluorescence signal from the sheath-expressed Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] (abbreviated as Plim-7::GOA-1::GFP) construct as a green overlay. (G) The sheath and spermathecal (Sp) expression patterns and levels from the single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021) were similar in A1 (top) control and (bottom) feminized fog-1(lf) mutants. (H) The (top) oma-1(ø); oma-2(lf) (n=18) double mutants usually maintain a state of relatively stable oocyte hyperplasia beyond A2 while all the (bottom) goa-1(lf); oma-1(ø); oma-2(lf) (n=22) triples have hyperaccumulated oocytes by then. A tumour penetrance percentage is shown as a coloured vertical bar on the right (blue, stable hyperplasia; red, oocyte hyperaccumulation/differentiated tumour). (I) Example of a younger tumorous goa-1(lf); oma-1(ø); oma-2(lf) mutant, slightly after it progressed beyond hyperplasia and clearly started to hyperaccumulate large oocyte-like differentiated germ cells. (F-I) Yellow dotted lines mark the region occupied by oocyte-like cells. Scale bars, 50 μm. (H-I) All strains contain cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)], marking germ membranes with green fluorescence. (B-H) Alleles, gsa-1(ce94)gf, fog-1(q253)ts, fog-1(q785)ø, goa-1(n1134)lf, vsSi32[goa-1::GFP + unc-119(+)], narEx166[pCAM37(Plim-7::GOA-1[N-term]::GFP::GOA-1[C-Term]); Pmyo-3::mCherry], oma-1(zu405te33)ø, oma-2(te51)lf.
","imageTitle":"GOA-1 suppresses GSC proliferation from the gonadal sheath cells
","methods":"C. elegans strains and maintenance
C. elegans strains were maintained at 15oC on standard nematode growth medium (NGM) seeded with E. coli (OP50) unless otherwise indicated. The Bristol (N2) isolate served as wild-type throughout (Brenner, 1974). Table 1 provides a complete list of the C. elegans strains and reagents used in this work.
Plasmid and transgenic strain
We used the Gibson method (Gibson et al., 2009) for plasmid assembly; primers are listed in Table 1. To achieve sheath-specific goa-1 rescue, the LX2060 strain carrying a single-copy insertion of a GOA-1::GFP translational fusion driven by 5 kb of goa-1 promoter (Kumar et al., 2021) was used to amplify the goa-1 N-term::GFP::goa-1 C-term genomic sequence (~4.5 kb). The resulting fragment was inserted downstream of the lim-7 promoter in a vector derived from pGC240 (Voutev et al., 2008). The integrity of the resulting pCAM37 plasmid was confirmed by XbaI restriction digestion. The microinjection mix consisted of three plasmids: pCAM37 at 50 ng/µL, pCFJ104 at 5 ng/µL (Frøkjær-Jensen et al., 2008) and pKSII as carrier DNA at 150 ng/µL. The mixture was microinjected into the germline syncytium of wild-type hermaphrodites (Mello et al., 1991) to establish and select an array that was subsequently crossed into the fog-1(ø) goa-1(lf) double mutant strain for assaying its rescuing activity.
Imaging and image processing
All hermaphrodites used for imaging or scoring were synchronized by picking late-L4 stage larvae, based on vulva development (Seydoux et al., 1993), to a new plate that was upshifted to 25 °C for an additional 24 hours to generate day-1 adults (referred to as A1) (Narbonne et al., 2015, 2017; Robinson-Thiewes et al., 2021) or 48 hours for A2. For live imaging, the resulting hermaphrodites were immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad.
Differential interference contrast (DIC) and epifluorescence images were acquired at 1 µm z-intervals using a Plan-Apochromat 20× dry objective (NA 0.8) mounted on an inverted Zeiss Axio Observer.Z1 microscope. For epifluorescence (Fig. 1G-H), samples were excited by a LED module at 488 nm (50% intensity, 100 ms exposure) and emission was collected at 500–550 nm. Stitching and deconvolution were performed using the Zen 3.8 software. For the high-resolution confocal fluorescence acquisition shown as a pseudo-DIC overlay in Fig. 1F (the Plim-7::GOA-1::GFP rescue image), coverslips were sealed with VALAP (1:1:1 Vaseline, lanolin, paraffin), and a single focal plane was acquired using a Leica Microsystems Stellaris 5 confocal microscope equipped with an HC PL APO CS2 63×/1.30 numerical aperture oil immersion objective. Samples were excited by a 488 nm laser (5% intensity) and emission was collected at 507–528 nm with a pinhole setting of 1. Specimens were digitally straightened using ImageJ.
Arrested oocyte quantification
For fog-1(lf), late-L4 hermaphrodites were upshifted from 15 °C to 25 °C and maintained at this temperature along with their F1 progeny for 3 days to prevent spermatogenesis (Barton & Kimble, 1990). The resulting late-L4 feminized F1 hermaphrodites were transferred onto fresh plates at 25 °C based on vulval morphology (Seydoux et al., 1993) and allowed to develop for another 24 hours to obtain A1. For the fog-1(ø) goa-1(lf) strain, non-fluorescent late-L4 hermaphrodites were picked from asynchronous cultures at 15 °C onto fresh plates at 25 °C. In both cases, the resulting feminized A1 were collected, immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad. Oocyte number per gonad arm was quantified by DIC microscopy by counting morphologically distinct diakinesis-stage oocytes extending distally from the spermatheca.
GSC mitotic index
The progenitor zone (PZ)/GSC mitotic index (MI) was assessed following a previously established protocol (Crittenden et al., 2006; Robinson-Thiewes et al., 2021). In brief, A1 hermaphrodites prepared as above were picked into a drop of 1X PBS placed on a coverslip and rapidly dissected using a surgical needle. The coverslip was then flipped onto a poly-L-lysine-coated slide and subjected to a standard -80 °C freeze-crack procedure. Samples were subsequently fixed in -20 °C methanol for 1 minute and post-fixed in a 3.7% paraformaldehyde solution (3.7% paraformaldehyde, 1X PBS, 0.08 M HEPES, 1.6 mM MgSO4, 0.8 mM EGTA, pH 7.4) for 30 minutes. After fixation, gonads were washed twice (10 minutes each) in PBST (PBS + 0.1% Tween 20) and then blocked in PBST + 3% BSA for 1 hour at room temperature. Primary antibody staining was performed overnight at 4 °C using polyclonal rabbit anti-WAPL-1 (1:500, Sdix #4930.00.02) to label GSCs and their proliferative progeny, along with mouse monoclonal anti-phospho[Ser10]-histone H3 antibodies (1:250, Cell Signaling #9706) to mark G2/M-phase nuclei (Kocsisova et al., 2018). The samples were washed three times (10 minutes each) in PBST before incubation with A488-conjugated goat anti-mouse (Cat# A-11029; RRID:AB138404) and A546-conjugated goat anti-rabbit (Cat# A-11035; RRID:AB143051) (1:500 each) secondary antibodies for 1 hour at room temperature. Slides were washed three times with PBST and briefly stained with 0.7 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) to visualize all nuclei. Vectashield™ mounting medium (Vector labs #H1900) was then applied, and the coverslip was sealed with nail polish. Prepared slides were stored at -20 °C until they were imaged. PZ nuclei counting in 3 dimensions was partially automated using an ImageJ plugin developed by Dr Jane Hubbard's laboratory (Korta et al., 2012).
Differentiated germline tumour scoring
Strains were maintained at 25 °C, and staged by picking GFP negative goa-1(lf); oma-1(ø); oma-2(lf) homozygous late-L4s to a new plate at 25 °C. The resulting animals were imaged 48 hours later (at A2). We classified individuals as tumorous if they contained obviously more oocyte-like cells than same-age stable hyperplastic oma-1(ø); oma-2(lf) controls (Clouet et al., 2025). Disorganized oocyte-like cells usually fill the uterus of tumorous animals but not of controls, facilitating the scoring of this phenotype.
Statistical analysis
All bar/dot plots were generated using GraphPad Prism 10.0. For each dataset, normality was verified using the Shapiro-Wilk test, and variance equality was assessed using the Brown-Forsythe test for multi-group comparisons. Tests were chosen according to the following criteria. For multi-group comparisons where all distributions were normal and variances equal, the one-way ANOVA with Tukey's multiple comparisons was used. When distributions were non-Gaussian, the Kruskal-Wallis test with Dunn's multiple comparisons was applied instead. Tests used for each dataset are indicated in the figure legend.
","reagents":"Strain/ plasmid name | Name in text/ description | Genotype/ source material | Source/ oligo sequences (5'-> 3') |
wild-type (WT) | wild-type | Caenorhabditis Genetics Center (Brenner, 1974) | |
fog-1(ø) | GFP-negative progeny of fog-1(q785)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | Caenorhabditis Genetics Center (Morgan et al., 2010) | |
JK560 | fog-1(lf) | Caenorhabditis Genetics Center (Barton & Kimble, 1990) | |
goa-1(lf) | Caenorhabditis Genetics Center | ||
gsa-1(gf) | (Castaneda et al., 2020) | ||
GFP-negative progeny of fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | (Narbonne et al., 2015) | ||
This study | |||
sheath::GOA-1(+) | narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study; see primer info at the end of table (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | |
fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); narEx166[pCAM37(Plim-7::GOA-1[N-term]::GFP::GOA-1[C-Term]); Pmyo-3::mCherry] | This study, (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | ||
(Kumar et al., 2021) | |||
fog-1(q253)ts I, vsSi32[Pgoa-1::GOA-1::GFP + unc-119(+)] III. | This study | ||
cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | (Clouet et al., 2025) | ||
goa-1(n1134) I; cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | This study | ||
pCAM37 | LX2060 gDNA for the insert; pXA9 (derived from pGC240 (Voutev et al. 2008) for the backbone. | Insert forward: TTGGAGGGTACCGGTAGAAAAAATGGGTTGTACCATGTCACAGGA Insert reverse: AGGGGAAACAAAATGAAGAGAATTTAATACAAGCCGCATCCACGAAG Backbone forward: CTTCGTGGATGCGGCTTGTATTAAATTCTCTTCATTTTGTTTCCCCT Backbone reverse: TCCTGTGACATGGTACAACCCATTTTTTCTACCGGTACCCTCCAA
| |
E. coli | Standard E. coli bacteria used as C. elegans food | Caenorhabditis Genetics Center |
Table 1. C. elegans strains and reagents used in this study.
","patternDescription":"Stem cells must divide often enough to replace cells lost to turnover and be able to increase their output in response to injuries. Yet their proliferation must also be constrained to prevent tissue overgrowth and tumorigenesis when differentiated cell turnover is reduced. This balance is achieved through homeostatic feedback loops that monitor differentiated tissue status and modulate stem/progenitor cell proliferation accordingly. At the molecular level, G protein-coupled receptor (GPCR) signalling has emerged as a key regulator of stem cell proliferation and homeostasis across diverse systems. GPCRs mediate stem cell responses to extracellular cues through heterotrimeric G proteins, with stimulatory (Gαs) and inhibitory (Gαi/o) pathways modulating stem cell division rates, self-renewal, and differentiation in multiple contexts (Kobayashi et al., 2010; Layden et al., 2010; Pedro et al., 2020). In Drosophila males for instance, germline stem cells (GSCs) increase their division frequency in response to mating-induced sperm depletion through a germ-autonomous G protein-dependent mechanism, directly demonstrating that GPCR signaling can couple stem cell output to physiological demand (Malpe et al., 2020). However, whether G protein signalling can non-autonomously contribute to tissue homeostasis has remained unclear.
The Caenorhabditis elegans germline provides a powerful in vivo system to elucidate how stem cell proliferation homeostasis is controlled. Hermaphrodites produce a finite number of sperm during larval development before shifting irreversibly to oocyte production in adults, with oogenesis continuing at a fast pace until sperm reserves are depleted (Fig. 1A). As sperm-secreted major sperm proteins (MSPs) actively stimulate meiotic maturation and ovulation (Miller et al., 2001), once sperm reserves are depleted, arrested oocytes accumulate until a homeostatic feedback signal suppresses GSC proliferation/differentiation to stabilize a state of oocyte hyperplasia (Morgan et al., 2010; Narbonne et al., 2015, 2017; Cinquin et al., 2016; Valet & Narbonne, 2022).
The antagonistic inhibitory Gαo/i GOA-1/GNAO1 and stimulatory Gαs GSA-1/GNAS1 have been identified as critical regulators of MSP/ovulation signalling, where the loss of goa-1 results in spontaneous ovulation in the absence of sperm/MSPs while conversely, the loss of gsa-1 activity prevents ovulation, even in the presence of sperm/MSPs (Govindan et al., 2006, 2009). Interestingly, a goa-1 loss-of-function (lf) further impaired GSC proliferation homeostasis in feminized fog-1(ø) spermless hermaphrodites (Narbonne et al., 2015). However, and especially since the loss of goa-1 is pleiotropic, also affecting behaviour and locomotion (Ségalat et al., 1995; Mendel et al., 1995), it remained unclear if the disruption of GSC proliferation homeostasis specifically resulted from the very same role that goa-1 has in MSP signal transduction.
Germ-specific RNAi and elegant mosaic analyses unequivocally supported a requirement for goa-1 and gsa-1 in the somatic gonad for the regulation of oocyte maturation and ovulation (Govindan et al., 2006, 2009; Korswagen et al., 1997). Further, a single mosaic individual for acy-4, encoding the adenylate cyclase acting downstream of these Gα proteins, more specifically indicated a sheath cell requirement for this gene in ovulation control (Govindan et al., 2009). However, whether gsa-1 and goa-1 activities are also acting specifically within the gonadal sheath cells, rather than in another somatic gonad tissue, has remained unconfirmed.
While the gonadal sheath and spermathecal cells derive from a common somatic precursor, GSA-1 was recently implicated in the control of spermathecal contractility through a molecular cascade that overlaps with MSP signalling (Castaneda et al., 2020). Given this shared developmental origin and our recent discovery that spermathecal neck contractility was key in preventing ovulation in feminized hermaphrodites (Deng et al., 2025), we deemed it important to determine whether sheath-specific goa-1 activity was sufficient to regulate both ovulation and germline stem cell proliferation homeostasis in feminized hermaphrodites.
We first reasoned that if GOA-1 and GSA-1 have opposing activities within both MSP signalling and homeostatic GSC proliferation control, activating gsa-1 with a gain-of-function (gf) allele should prevent GSC downregulation in feminized hermaphrodites, like the loss of goa-1. Consistent with this, gsa-1(gf) prevented oocyte accumulation in feminized hermaphrodites and blocked the downregulation of GSC proliferation (Fig. 1B-C). To directly test the gonadal sheath requirement for goa-1, we used a standard extrachromosomal array transgene (Mello et al., 1991) to restore goa-1 specifically in this tissue within feminized goa-1(lf) mutants, using the sheath-specific lim-7 promoter (Voutev et al., 2009). As conventional N- or C-terminal tagging of Gα proteins can impair their function (Hynes et al., 2004), Kumar et al. inserted a GFP tag between residues 117-118 of GOA-1 to create a functional single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021). We used this strain as a starting point to generate a Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] extrachromosomal array, abbreviated as Plim-7::GOA-1::GFP. The resulting transgene effectively rescued both oocyte accumulation and GSC MI downregulation in fog-1(ø) goa-1(lf) hermaphrodites (Fig. 1D-F). We also examined whether sheath or spermathecal expression from a Pgoa-1::GOA-1::GFP single-copy transgene (Kumar et al., 2021) were altered by feminization, but no obvious changes were observed (Fig. 1G). Together with earlier findings (Govindan et al., 2006, 2009), our results provide strong evidence that GOA-1 acts specifically within the gonadal sheath to prevent spontaneous ovulation events in the absence of sperm/MSP to permit oocyte accumulation, and at the same time yet indirectly, to non-autonomously promote homeostatic downregulation of GSC proliferation.
Similar to the loss of GOA-1, loss of the AMPK α-catalytic subunit AAK-1 caused spontaneous ovulation and prevented homeostatic GSC downregulation in feminized hermaphrodites (Narbonne et al., 2017). The specific suppression of oocyte maturation through the inactivation of OMA-1,2 proteins (Detwiler et al., 2001) restored oocyte accumulation in aak-1(ø) mutants but failed to reinstate homeostatic GSC downregulation, resulting in the formation of benign differentiated germline tumours akin to hamartomas, in which differentiated oocyte-like cells hyperaccumulate in a disorganized manner as a consequence of homeostatically unchecked GSC proliferation (Ali & Mulita, 2023; Narbonne et al., 2017; Valet & Narbonne, 2022). We find that likewise, reduced goa-1 activity in an oma-1(ø); oma-2(lf) background provokes a hyperaccumulation of oocyte-like cells (Fig. 1H-I). The similarity of the goa-1(lf) and aak-1(ø) phenotypes raises the intriguing possibility that aak-1 may essentially permit sheath Gα signals to suppress oocyte maturation and ovulation in the absence of sperm.
Altogether, our results reveal that the stimulatory Gα GOA-1/GNAO1 ensures homeostatic GSC downregulation in spermless adult hermaphrodite C. elegans non-autonomously from the gonadal sheath cells, likely through its known roles in MSP responses and ovulation control. G-protein signalling may therefore non-autonomously regulate stem cell proliferation rates in various organisms and tissues in addition to having cell autonomous roles.
","references":[{"reference":"Ali SA, Mulita F. 2023. Hamartoma. StatPearls Publishing.
","pubmedId":"32965969","doi":""},{"reference":"Brenner S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77(1), 71–94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Barton MK, Kimble J. 1990. fog-1, a regulatory gene required for specification of spermatogenesis in the germ line of Caenorhabditis elegans. Genetics 125: 29-39.
","pubmedId":"","doi":"10.1093/genetics/125.1.29"},{"reference":"Castaneda PG, Cecchetelli AD, Pettit HN, Cram EJ. 2020. Gα/GSA-1 works upstream of PKA/KIN-1 to regulate calcium signaling and contractility in the Caenorhabditis elegans spermatheca. PLOS Genetics 16: e1008644.
","pubmedId":"","doi":"10.1371/journal.pgen.1008644"},{"reference":"Cinquin A, Chiang M, Paz A, Hallman S, Yuan O, Vysniauskaite I, Fowlkes CC, Cinquin O. 2016. Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line. PLOS Genetics 12: e1005985.
","pubmedId":"","doi":"10.1371/journal.pgen.1005985"},{"reference":"Clouet, Alexandre and Valet, Matthieu and Dufour, Benjamin and Rieger, Janina and Lechasseur, Xavier and Condomat Zoumabo, Aurelia Thérèse and Fotso Dzuna, Lloyd Venceslas and Murray, Alexane and Deng, Jichao and Martel, Pier-Olivier and Narbonne, Patrick, Non-Autonomous PMK-1/p38 MAPK Signaling Ensures Homeostatic Downregulation of Germline Stem Cell Proliferation in C. elegans.
","pubmedId":"","doi":"10.2139/ssrn.6731281"},{"reference":"Crittenden, S. L., Leonhard, K. A., Byrd, D. T., & Kimble, J. (2006). Cellular Analyses of the Mitotic Region in the Caenorhabditis elegans Adult Germ Line. Molecular Biology of the Cell, 17, 3051–3061
","pubmedId":"","doi":"10.1091/mbc.E06"},{"reference":"Deng J, Chaudhari AM, Gagné O, Roy V, Dufour B, Martel PO, Simard MJ, Narbonne P. 2025. DAF-18/PTEN prevents oocyte wastage in spermless\n C. elegans\n hermaphrodites by blocking spermatheca neck dilation through RHO-1/RhoA disinhibition. : 10.1101/2025.09.16.676617.
","pubmedId":"","doi":"10.1101/2025.09.16.676617"},{"reference":"Detwiler MR, Reuben M, Li X, Rogers E, Lin R. 2001. Two Zinc Finger Proteins, OMA-1 and OMA-2, Are Redundantly Required for Oocyte Maturation in C. elegans. Developmental Cell 1: 187-199.
","pubmedId":"","doi":"10.1016/s1534-5807(01)00026-0"},{"reference":"Frøkjær-Jensen C, Wayne Davis M, Hopkins CE, Newman BJ, Thummel JM, Olesen SrP, Grunnet M, Jorgensen EM. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics 40: 1375-1383.
","pubmedId":"","doi":"10.1038/ng.248"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Govindan JA, Cheng H, Harris JE, Greenstein D. 2006. Gαo/i and Gαs Signaling Function in Parallel with the MSP/Eph Receptor to Control Meiotic Diapause in C. elegans. Current Biology 16: 1257-1268.
","pubmedId":"","doi":"10.1016/j.cub.2006.05.020"},{"reference":"Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D. 2009. Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation in C. elegans. Development 136: 2211-2221.
","pubmedId":"","doi":"10.1242/dev.034595"},{"reference":"Hynes TR, Hughes TE, Berlot CH. Cellular localization of GFP-tagged alpha subunits. Methods Mol Biol. 2004;237:233-46. PMID: 14501054.
","pubmedId":"","doi":"10.1385/1-59259-430-1:233"},{"reference":"Kobayashi NR, Hawes SM, Crook JM, Pébay A. 2010. G-protein Coupled Receptors in Stem Cell Self-Renewal and Differentiation. Stem Cell Reviews and Reports 6: 351-366.
","pubmedId":"","doi":"10.1007/s12015-010-9167-9"},{"reference":"Kocsisova Z, Kornfeld K, Schedl T. 2018. Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans. BMC Developmental Biology 18: 10.1186/s12861-018-0171-7.
","pubmedId":"","doi":"10.1186/s12861-018-0171-7"},{"reference":"Korswagen HC, Park JH, Ohshima Y, Plasterk RH. 1997. An activating mutation in a Caenorhabditis elegans Gs protein induces neural degeneration.. Genes & Development 11: 1493-1503.
","pubmedId":"","doi":"10.1101/gad.11.12.1493"},{"reference":"Korta DZ, Tuck S, Hubbard EJ. 2012. S6K links cell fate, cell cycle and nutrient response in C. elegans germline stem/progenitor cells. Development 139(5): 859-70.
","pubmedId":"22278922","doi":""},{"reference":"Kumar S, Olson AC, Koelle MR. 2021. The neural G protein Gαo tagged with GFP at an internal loop is functional in\n Caenorhabditis elegans. G3 Genes|Genomes|Genetics 11: 10.1093/g3journal/jkab167.
","pubmedId":"","doi":"10.1093/g3journal/jkab167"},{"reference":"Layden BT, Newman M, Chen F, Fisher A, Lowe WL. 2010. G Protein Coupled Receptors in Embryonic Stem Cells: A Role for Gs-Alpha Signaling. PLoS ONE 5: e9105.
","pubmedId":"","doi":"10.1371/journal.pone.0009105"},{"reference":"Lee MH, Ohmachi M, Arur S, Nayak S, Francis R, Church D, Lambie E, Schedl T. 2007. Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling in Caenorhabditis elegans Germline Development. Genetics 177: 2039-2062.
","pubmedId":"","doi":"10.1534/genetics.107.081356"},{"reference":"Malpe MS, McSwain LF, Kudyba K, Ng CL, Nicholson J, Brady M, et al., Schulz. 2020. G-protein signaling is required for increasing germline stem cell division frequency in response to mating in Drosophila males. Scientific Reports 10: 10.1038/s41598-020-60807-8.
","pubmedId":"","doi":"10.1038/s41598-020-60807-8"},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. The EMBO Journal 10: 3959-3970.
","pubmedId":"","doi":"10.1002/j.1460-2075.1991.tb04966.x"},{"reference":"Mendel JE, Korswagen HC, Liu KS, Hajdu-Cronin YM, Simon MI, Plasterk RHA, Sternberg PW. 1995. Participation of the Protein G\n o\n in Multiple Aspects of Behavior in\n C. elegans. Science 267: 1652-1655.
","pubmedId":"","doi":"10.1126/science.7886455"},{"reference":"Miller MA, Nguyen VQ, Lee MH, Kosinski M, Schedl T, Caprioli RM, Greenstein D. 2001. A Sperm Cytoskeletal Protein That Signals Oocyte Meiotic Maturation and Ovulation. Science 291: 2144-2147.
","pubmedId":"","doi":"10.1126/science.1057586"},{"reference":"Morgan DE, Crittenden SL, Kimble J. 2010. The C. elegans adult male germline: Stem cells and sexual dimorphism. Developmental Biology 346: 204-214.
","pubmedId":"","doi":"10.1016/j.ydbio.2010.07.022"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2015. daf-18/PTEN locally antagonizes insulin signalling to couple germline stem cell proliferation to oocyte needs in C. elegans. Development : 10.1242/dev.130252.
","pubmedId":"","doi":"10.1242/dev.130252"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2017. DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation. PLOS Genetics 13: e1006738.
","pubmedId":"","doi":"10.1371/journal.pgen.1006738"},{"reference":"Pedro MP, Lund K, Iglesias-Bartolome R. 2020. The landscape of GPCR signaling in the regulation of epidermal stem cell fate and skin homeostasis. Stem Cells 38: 1520-1531.
","pubmedId":"","doi":"10.1002/stem.3273"},{"reference":"Robinson-Thiewes S, Dufour B, Martel PO, Lechasseur X, Brou AAD, Roy V, et al., Narbonne. 2021. Non-autonomous regulation of germline stem cell proliferation by somatic MPK-1/MAPK activity in C. elegans. Cell Reports 35: 109162.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109162"},{"reference":"Ségalat L, Elkes DA, Kaplan JM. 1995. Modulation of Serotonin-Controlled Behaviors by G\n o\n in\n Caenorhabditis elegans. Science 267: 1648-1651.
","pubmedId":"","doi":"10.1126/science.7886454"},{"reference":"Seydoux G, Salvage C, Greenwald I. 1993. Isolation and Characterization of Mutations Causing Abnormal Eversion of the Vulva in Caenorhabditis elegans. Developmental Biology 157: 423-436.
","pubmedId":"","doi":"10.1006/DBIO.1993.1146"},{"reference":"Valet M, Narbonne P. 2022. Formation of benign tumors by stem cell deregulation. PLOS Genetics 18: e1010434.
","pubmedId":"","doi":"10.1371/journal.pgen.1010434"},{"reference":"Voutev R, Keating R, Jane Albert Hubbard E, Vallier LG. 2008. Characterization of the\n Caenorhabditis elegans\n Islet\n LIM‐homeodomain ortholog,\n lim‐7. FEBS Letters 583: 456-464.
","pubmedId":"","doi":"10.1016/j.febslet.2008.12.046"}],"title":"The Gα GOA-1/GNAO1 non-autonomously promotes germline stem cell quiescence in feminized C. elegans hermaphrodites from the gonadal sheath cells
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1786749385433"}]},{"id":"6b1dc26e-cd2c-42cd-81b3-818be53fe17b","decision":"publish","abstract":"Stem cell proliferation rates must be precisely regulated as insufficient proliferation leads to tissue loss, whereas excessive proliferation causes tumorigenesis and cancer. A homeostatic balance is therefore achieved through feedback loops that adjust stem/progenitor cell proliferation rates to match the demand for their differentiated progeny. While such a homeostatic feedback mechanism adjusts germline stem cell (GSC) proliferation rates to oocyte needs in the Caenorhabditis elegans adult hermaphrodite germline, its inner workings are incompletely understood. Here we show that the Gα GOA-1/GNAO1 is required specifically in the gonadal sheath cells to non-autonomously promote GSC quiescence in spermless hermaphrodites. Given that dysregulation of G protein signalling is frequently observed in human cancers, Gα dependent homeostatic control of stem cell proliferation may represent a conserved tumour suppressive mechanism.
","acknowledgements":"We thank the Caenorhabditis Genetics Center (CGC) for providing strains and WormBase for curating and maintaining the genomic and phenotypic data used in this study.
","authors":[{"affiliations":["University of Quebec at Trois-Rivières, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["writing_originalDraft","conceptualization","dataCuration","formalAnalysis","methodology","validation"],"email":"armichaudhary97@gmail.com","firstName":"Armi M","lastName":"Chaudhari","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7908-2157"},{"affiliations":["University of Quebec at Trois-Rivières, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale"],"credit":["methodology"],"email":"thuminhnguyen1909@gmail.com","firstName":"Minh Thu ","lastName":"Nguyen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Quebec at Trois-Rivières, Trois-Rivières, QC, Canada"],"departments":["Département de Biologie Médicale",""],"credit":["conceptualization","fundingAcquisition","investigation","project","resources","supervision","validation","writing_reviewEditing","formalAnalysis"],"email":"patrick.narbonne@uqtr.ca","firstName":"Patrick","lastName":"Narbonne","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Research in the Narbonne Laboratory is funded by grants awarded to PN from the Fondation Marcel & Rolande Gosselin, the Natural Sciences and Engineering Research Council of Canada (RGPIN-2026-05498), the Fonds de recherche du Québec – Santé (310643) and the Canadian Institutes of Health Research (PJT-169138). AC is financially supported by a PBEEE scholarship (332795) and a doctoral scholarship from the Fonds de recherche du Québec – Santé (367752). MTN was supported by the Canada-ASEAN Scholarship and Educational Exchanges for Development (SEED) program.
","image":{"url":"https://portal.micropublication.org/uploads/15097193bb263ad949577d8db41fa718.jpg"},"imageCaption":"(A) Model for homeostatic regulation of germline stem/progenitor cell (GSC) proliferation rates in adult C. elegans hermaphrodites. GSCs located in the distal progenitor zone (PZ) generate daughters that, upon exiting the niche, differentiate into oocytes. Major sperm proteins (MSPs) released by sperm stimulate oocyte maturation and ovulation via G-protein coupled receptors and cAMP signalling in the gonadal sheath cells (Govindan et al., 2006, 2009) to establish oocyte demand. A strong oocyte demand in turn promotes MPK-1/ERK-dependent GSC proliferation (Lee et al., 2007; Narbonne et al., 2017; Robinson-Thiewes et al., 2021). (B-E) The number of (B, D) oocytes in diakinesis per gonad arm and (C, E) the GSC mitotic index of day-1 adult (A1) hermaphrodites of the indicated genotypes were scored. Each bar represents the mean ± standard deviation, and each point represents the value from a single gonad arm; one or both arms per individual were scored. Triple asterisks indicate statistical significance vs the wild-type (P<0.001). Statistical analyses used a one-way ANOVA followed by Tukey's multiple comparisons for (B, D) and the Kruskal–Wallis test followed by Dunn's multiple comparisons for (C, E). ns, not significant. (F) Representative differential interference contrast (DIC) micrographs of proximal gonads of A1 hermaphrodites of the indicated genotypes. The bottom panel shows the epifluorescence signal from the sheath-expressed Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] (abbreviated as Plim-7::GOA-1::GFP) construct as a green overlay. (G) The sheath and spermathecal (Sp) expression patterns and levels from the single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021) were similar in A1 (top) control and (bottom) feminized fog-1(lf) mutants. (H) The (top) oma-1(ø); oma-2(lf) (n=18) double mutants usually maintain a state of relatively stable oocyte hyperplasia beyond A2 while all the (bottom) goa-1(lf); oma-1(ø); oma-2(lf) (n=22) triples have hyperaccumulated oocytes by then. A tumour penetrance percentage is shown as a coloured vertical bar on the right (blue, stable hyperplasia; red, oocyte hyperaccumulation/differentiated tumour). (I) Example of a younger tumorous goa-1(lf); oma-1(ø); oma-2(lf) mutant, slightly after it progressed beyond hyperplasia and clearly started to hyperaccumulate large oocyte-like differentiated germ cells. (F-I) Yellow dotted lines mark the region occupied by oocyte-like cells. Scale bars, 50 μm. (H-I) All strains contain cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)], marking germ membranes with green fluorescence. (B-H) Alleles, gsa-1(ce94)gf, fog-1(q253)ts, fog-1(q785)ø, goa-1(n1134)lf, vsSi32[goa-1::GFP + unc-119(+)], narEx166[pCAM37(Plim-7::GOA-1[N-term]::GFP::GOA-1[C-Term]); Pmyo-3::mCherry], oma-1(zu405te33)ø, oma-2(te51)lf.
","imageTitle":"GOA-1 suppresses GSC proliferation from the gonadal sheath cells
","methods":"C. elegans strains and maintenance
C. elegans strains were maintained at 15oC on standard nematode growth medium (NGM) seeded with E. coli (OP50) unless otherwise indicated. The Bristol (N2) isolate served as wild-type throughout (Brenner, 1974). Table 1 provides a complete list of the C. elegans strains and reagents used in this work.
Plasmid and transgenic strain
We used the Gibson method (Gibson et al., 2009) for plasmid assembly; primers are listed in Table 1. To achieve sheath-specific goa-1 rescue, the LX2060 strain carrying a single-copy insertion of a GOA-1::GFP translational fusion driven by 5 kb of goa-1 promoter (Kumar et al., 2021) was used to amplify the goa-1 N-term::GFP::goa-1 C-term genomic sequence (~4.5 kb). The resulting fragment was inserted downstream of the lim-7 promoter in a vector derived from pGC240 (Voutev et al., 2008). The integrity of the resulting pCAM37 plasmid was confirmed by XbaI restriction digestion. The microinjection mix consisted of three plasmids: pCAM37 at 50 ng/µL, pCFJ104 at 5 ng/µL (Frøkjær-Jensen et al., 2008) and pKSII as carrier DNA at 150 ng/µL. The mixture was microinjected into the germline syncytium of wild-type hermaphrodites (Mello et al., 1991) to establish and select an array that was subsequently crossed into the fog-1(ø) goa-1(lf) double mutant strain for assaying its rescuing activity.
Imaging and image processing
All hermaphrodites used for imaging or scoring were synchronized by picking late-L4 stage larvae, based on vulva development (Seydoux et al., 1993), to a new plate that was upshifted to 25 °C for an additional 24 hours to generate day-1 adults (referred to as A1) (Narbonne et al., 2015, 2017; Robinson-Thiewes et al., 2021) or 48 hours for A2. For live imaging, the resulting hermaphrodites were immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad.
Differential interference contrast (DIC) and epifluorescence images were acquired at 1 µm z-intervals using a Plan-Apochromat 20× dry objective (NA 0.8) mounted on an inverted Zeiss Axio Observer.Z1 microscope. For epifluorescence (Fig. 1G-H), samples were excited by a LED module at 488 nm (50% intensity, 100 ms exposure) and emission was collected at 500–550 nm. Stitching and deconvolution were performed using the Zen 3.8 software. For the high-resolution confocal fluorescence acquisition shown as a pseudo-DIC overlay in Fig. 1F (the Plim-7::GOA-1::GFP rescue image), coverslips were sealed with VALAP (1:1:1 Vaseline, lanolin, paraffin), and a single focal plane was acquired using a Leica Microsystems Stellaris 5 confocal microscope equipped with an HC PL APO CS2 63×/1.30 numerical aperture oil immersion objective. Samples were excited by a 488 nm laser (5% intensity) and emission was collected at 507–528 nm with a pinhole setting of 1. Specimens were digitally straightened using ImageJ.
Arrested oocyte quantification
For fog-1(lf), late-L4 hermaphrodites were upshifted from 15 °C to 25 °C and maintained at this temperature along with their F1 progeny for 3 days to prevent spermatogenesis (Barton & Kimble, 1990). The resulting late-L4 feminized F1 hermaphrodites were transferred onto fresh plates at 25 °C based on vulval morphology (Seydoux et al., 1993) and allowed to develop for another 24 hours to obtain A1. For the fog-1(ø) goa-1(lf) strain, non-fluorescent late-L4 hermaphrodites were picked from asynchronous cultures at 15 °C onto fresh plates at 25 °C. In both cases, the resulting feminized A1 were collected, immobilized in a 0.1% tetramisole (Sigma, L9756) M9 solution and mounted on a 3% agarose M9 pad. Oocyte number per gonad arm was quantified by DIC microscopy by counting morphologically distinct diakinesis-stage oocytes extending distally from the spermatheca.
GSC mitotic index
The progenitor zone (PZ)/GSC mitotic index (MI) was assessed following a previously established protocol (Crittenden et al., 2006; Robinson-Thiewes et al., 2021). In brief, A1 hermaphrodites prepared as above were picked into a drop of 1X PBS placed on a coverslip and rapidly dissected using a surgical needle. The coverslip was then flipped onto a poly-L-lysine-coated slide and subjected to a standard -80 °C freeze-crack procedure. Samples were subsequently fixed in -20 °C methanol for 1 minute and post-fixed in a 3.7% paraformaldehyde solution (3.7% paraformaldehyde, 1X PBS, 0.08 M HEPES, 1.6 mM MgSO4, 0.8 mM EGTA, pH 7.4) for 30 minutes. After fixation, gonads were washed twice (10 minutes each) in PBST (PBS + 0.1% Tween 20) and then blocked in PBST + 3% BSA for 1 hour at room temperature. Primary antibody staining was performed overnight at 4 °C using polyclonal rabbit anti-WAPL-1 (1:500, Sdix #4930.00.02) to label GSCs and their proliferative progeny, along with mouse monoclonal anti-phospho[Ser10]-histone H3 antibodies (1:250, Cell Signaling #9706) to mark G2/M-phase nuclei (Kocsisova et al., 2018). The samples were washed three times (10 minutes each) in PBST before incubation with A488-conjugated goat anti-mouse (Cat# A-11029; RRID:AB138404) and A546-conjugated goat anti-rabbit (Cat# A-11035; RRID:AB143051) (1:500 each) secondary antibodies for 1 hour at room temperature. Slides were washed three times with PBST and briefly stained with 0.7 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) to visualize all nuclei. Vectashield™ mounting medium (Vector labs #H1900) was then applied, and the coverslip was sealed with nail polish. Prepared slides were stored at -20 °C until they were imaged. PZ nuclei counting in 3 dimensions was partially automated using an ImageJ plugin developed by Dr Jane Hubbard's laboratory (Korta et al., 2012).
Differentiated germline tumour scoring
Strains were maintained at 25 °C, and staged by picking GFP negative goa-1(lf); oma-1(ø); oma-2(lf) homozygous late-L4s to a new plate at 25 °C. The resulting animals were imaged 48 hours later (at A2). We classified individuals as tumorous if they contained obviously more oocyte-like cells than same-age stable hyperplastic oma-1(ø); oma-2(lf) controls (Clouet et al., 2025). Disorganized oocyte-like cells usually fill the uterus of tumorous animals but not of controls, facilitating the scoring of this phenotype.
Statistical analysis
All bar/dot plots were generated using GraphPad Prism 10.0. For each dataset, normality was verified using the Shapiro-Wilk test, and variance equality was assessed using the Brown-Forsythe test for multi-group comparisons. Tests were chosen according to the following criteria. For multi-group comparisons where all distributions were normal and variances equal, the one-way ANOVA with Tukey's multiple comparisons was used. When distributions were non-Gaussian, the Kruskal-Wallis test with Dunn's multiple comparisons was applied instead. Tests used for each dataset are indicated in the figure legend.
","reagents":"Strain/ plasmid name | Name in text/ description | Genotype/ source material | Source/ oligo sequences (5'-> 3') |
wild-type (WT) | wild-type | Caenorhabditis Genetics Center (Brenner, 1974) | |
fog-1(ø) | GFP-negative progeny of fog-1(q785)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | Caenorhabditis Genetics Center (Morgan et al., 2010) | |
JK560 | fog-1(lf) | Caenorhabditis Genetics Center (Barton & Kimble, 1990) | |
goa-1(lf) | Caenorhabditis Genetics Center | ||
gsa-1(gf) | (Castaneda et al., 2020) | ||
GFP-negative progeny of fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) | (Narbonne et al., 2015) | ||
This study | |||
sheath::GOA-1(+) | narEx166[pCAM37(Plim-7::GOA-1 N-term::GFP::GOA-1 C-Term); Pmyo-3::mCherry] | This study; see primer info at the end of table (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | |
fog-1(q785) goa-1(n1134)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); narEx166[pCAM37(Plim-7::GOA-1[N-term]::GFP::GOA-1[C-Term]); Pmyo-3::mCherry] | This study, (Frøkjær-Jensen et al., 2008; Kumar et al., 2021) | ||
(Kumar et al., 2021) | |||
fog-1(q253)ts I, vsSi32[Pgoa-1::GOA-1::GFP + unc-119(+)] III. | This study | ||
cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | (Clouet et al., 2025) | ||
goa-1(n1134) I; cpSi42[Pmex-5::mNeonGreen::PLCδ-PH::tbb-2 3'UTR + unc-119(+)] II; oma-1(zu405te33)/nT1 [qIs51] IV; oma-2(te51)/nT1 V | This study | ||
pCAM37 | LX2060 gDNA for the insert; pXA9 (derived from pGC240 (Voutev et al. 2008) for the backbone. | Insert forward: TTGGAGGGTACCGGTAGAAAAAATGGGTTGTACCATGTCACAGGA Insert reverse: AGGGGAAACAAAATGAAGAGAATTTAATACAAGCCGCATCCACGAAG Backbone forward: CTTCGTGGATGCGGCTTGTATTAAATTCTCTTCATTTTGTTTCCCCT Backbone reverse: TCCTGTGACATGGTACAACCCATTTTTTCTACCGGTACCCTCCAA
| |
E. coli | Standard E. coli bacteria used as C. elegans food | Caenorhabditis Genetics Center |
Table 1. C. elegans strains and reagents used in this study.
","patternDescription":"Stem cells must divide often enough to replace cells lost to turnover and be able to increase their output in response to injuries. Yet their proliferation must also be constrained to prevent tissue overgrowth and tumorigenesis when differentiated cell turnover is reduced. This balance is achieved through homeostatic feedback loops that monitor differentiated tissue status and modulate stem/progenitor cell proliferation accordingly. At the molecular level, G protein-coupled receptor (GPCR) signalling has emerged as a key regulator of stem cell proliferation and homeostasis across diverse systems. GPCRs mediate stem cell responses to extracellular cues through heterotrimeric G proteins, with stimulatory (Gαs) and inhibitory (Gαi/o) pathways modulating stem cell division rates, self-renewal, and differentiation in multiple contexts (Kobayashi et al., 2010; Layden et al., 2010; Pedro et al., 2020). In Drosophila males for instance, germline stem cells (GSCs) increase their division frequency in response to mating-induced sperm depletion through a germ-autonomous G protein-dependent mechanism, directly demonstrating that GPCR signaling can couple stem cell output to physiological demand (Malpe et al., 2020). However, whether G protein signalling can non-autonomously contribute to tissue homeostasis has remained unclear.
The Caenorhabditis elegans germline provides a powerful in vivo system to elucidate how stem cell proliferation homeostasis is controlled. Hermaphrodites produce a finite number of sperm during larval development before shifting irreversibly to oocyte production in adults, with oogenesis continuing at a fast pace until sperm reserves are depleted (Fig. 1A). As sperm-secreted major sperm proteins (MSPs) actively stimulate meiotic maturation and ovulation (Miller et al., 2001), once sperm reserves are depleted, arrested oocytes accumulate until a homeostatic feedback signal suppresses GSC proliferation/differentiation to stabilize a state of oocyte hyperplasia (Morgan et al., 2010; Narbonne et al., 2015, 2017; Cinquin et al., 2016; Valet & Narbonne, 2022).
The antagonistic inhibitory Gαo/i GOA-1/GNAO1 and stimulatory Gαs GSA-1/GNAS1 have been identified as critical regulators of MSP/ovulation signalling, where the loss of goa-1 results in spontaneous ovulation in the absence of sperm/MSPs while conversely, the loss of gsa-1 activity prevents ovulation, even in the presence of sperm/MSPs (Govindan et al., 2006, 2009). Interestingly, a goa-1 loss-of-function (lf) further impaired GSC proliferation homeostasis in feminized fog-1(ø) spermless hermaphrodites (Narbonne et al., 2015). However, and especially since the loss of goa-1 is pleiotropic, also affecting behaviour and locomotion (Ségalat et al., 1995; Mendel et al., 1995), it remained unclear if the disruption of GSC proliferation homeostasis specifically resulted from the very same role that goa-1 has in MSP signal transduction.
Germ-specific RNAi and elegant mosaic analyses unequivocally supported a requirement for goa-1 and gsa-1 in the somatic gonad for the regulation of oocyte maturation and ovulation (Govindan et al., 2006, 2009; Korswagen et al., 1997). Further, a single mosaic individual for acy-4, encoding the adenylate cyclase acting downstream of these Gα proteins, more specifically indicated a sheath cell requirement for this gene in ovulation control (Govindan et al., 2009). However, whether gsa-1 and goa-1 activities are also acting specifically within the gonadal sheath cells, rather than in another somatic gonad tissue, has remained unconfirmed.
While the gonadal sheath and spermathecal cells derive from a common somatic precursor, GSA-1 was recently implicated in the control of spermathecal contractility through a molecular cascade that overlaps with MSP signalling (Castaneda et al., 2020). Given this shared developmental origin and our recent discovery that spermathecal neck contractility was key in preventing ovulation in feminized hermaphrodites (Deng et al., 2025), we deemed it important to determine whether sheath-specific goa-1 activity was sufficient to regulate both ovulation and germline stem cell proliferation homeostasis in feminized hermaphrodites.
We first reasoned that if GOA-1 and GSA-1 have opposing activities within both MSP signalling and homeostatic GSC proliferation control, activating gsa-1 with a gain-of-function (gf) allele should prevent GSC downregulation in feminized hermaphrodites, like the loss of goa-1. Consistent with this, gsa-1(gf) prevented oocyte accumulation in feminized hermaphrodites and blocked the downregulation of GSC proliferation (Fig. 1B-C). To directly test the gonadal sheath requirement for goa-1, we used a standard extrachromosomal array transgene (Mello et al., 1991) to restore goa-1 specifically in this tissue within feminized goa-1(lf) mutants, using the sheath-specific lim-7 promoter (Voutev et al., 2009). As conventional N- or C-terminal tagging of Gα proteins can impair their function (Hynes et al., 2004), Kumar et al. inserted a GFP tag between residues 117-118 of GOA-1 to create a functional single-copy Pgoa-1::GOA-1::GFP insertion (Kumar et al., 2021). We used this strain as a starting point to generate a Plim-7::GOA-1[N-term]::GFP::GOA-1[C-term] extrachromosomal array, abbreviated as Plim-7::GOA-1::GFP. The resulting transgene effectively rescued both oocyte accumulation and GSC MI downregulation in fog-1(ø) goa-1(lf) hermaphrodites (Fig. 1D-F). We also examined whether sheath or spermathecal expression from a Pgoa-1::GOA-1::GFP single-copy transgene (Kumar et al., 2021) were altered by feminization, but no obvious changes were observed (Fig. 1G). Together with earlier findings (Govindan et al., 2006, 2009), our results provide strong evidence that GOA-1 acts specifically within the gonadal sheath to prevent spontaneous ovulation events in the absence of sperm/MSP to permit oocyte accumulation, and at the same time yet indirectly, to non-autonomously promote homeostatic downregulation of GSC proliferation.
Similar to the loss of GOA-1, loss of the AMPK α-catalytic subunit AAK-1 caused spontaneous ovulation and prevented homeostatic GSC downregulation in feminized hermaphrodites (Narbonne et al., 2017). The specific suppression of oocyte maturation through the inactivation of OMA-1,2 proteins (Detwiler et al., 2001) restored oocyte accumulation in aak-1(ø) mutants but failed to reinstate homeostatic GSC downregulation, resulting in the formation of benign differentiated germline tumours akin to hamartomas, in which differentiated oocyte-like cells hyperaccumulate in a disorganized manner as a consequence of homeostatically unchecked GSC proliferation (Ali & Mulita, 2023; Narbonne et al., 2017; Valet & Narbonne, 2022). We find that likewise, reduced goa-1 activity in an oma-1(ø); oma-2(lf) background provokes a hyperaccumulation of oocyte-like cells (Fig. 1H-I). The similarity of the goa-1(lf) and aak-1(ø) phenotypes raises the intriguing possibility that aak-1 may essentially permit sheath Gα signals to suppress oocyte maturation and ovulation in the absence of sperm.
Altogether, our results reveal that the stimulatory Gα GOA-1/GNAO1 ensures homeostatic GSC downregulation in spermless adult hermaphrodite C. elegans non-autonomously from the gonadal sheath cells, likely through its known roles in MSP responses and ovulation control. G-protein signalling may therefore non-autonomously regulate stem cell proliferation rates in various organisms and tissues in addition to having cell autonomous roles.
","references":[{"reference":"Ali SA, Mulita F. 2023. Hamartoma. StatPearls Publishing.
","pubmedId":"32965969","doi":""},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics, 77(1), 71–94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Barton MK, Kimble J. 1990. fog-1, a regulatory gene required for specification of spermatogenesis in the germ line of Caenorhabditis elegans. Genetics 125: 29-39.
","pubmedId":"","doi":"10.1093/genetics/125.1.29"},{"reference":"Castaneda PG, Cecchetelli AD, Pettit HN, Cram EJ. 2020. Gα/GSA-1 works upstream of PKA/KIN-1 to regulate calcium signaling and contractility in the Caenorhabditis elegans spermatheca. PLOS Genetics 16: e1008644.
","pubmedId":"","doi":"10.1371/journal.pgen.1008644"},{"reference":"Cinquin A, Chiang M, Paz A, Hallman S, Yuan O, Vysniauskaite I, Fowlkes CC, Cinquin O. 2016. Intermittent Stem Cell Cycling Balances Self-Renewal and Senescence of the C. elegans Germ Line. PLOS Genetics 12: e1005985.
","pubmedId":"","doi":"10.1371/journal.pgen.1005985"},{"reference":"Clouet A, Valet M, Dufour B, Rieger J, Lechasseur X, Condomat Zoumabo AT, Fotso Dzuna LV, Murray A, Deng J, Martel PO, Narbonne P. 2026. Non-Autonomous PMK-1/p38 MAPK Signaling Ensures Homeostatic Downregulation of Germline Stem Cell Proliferation in C. elegans.
","pubmedId":"","doi":"10.2139/ssrn.6731281"},{"reference":"Crittenden SL, Leonhard KA, Byrd DT, Kimble J. 2006. Cellular Analyses of the Mitotic Region in the Caenorhabditis elegans Adult Germ Line. Molecular Biology of the Cell, 17, 3051–3061
","pubmedId":"","doi":"10.1091/mbc.E06"},{"reference":"Deng J, Chaudhari AM, Gagné O, Roy V, Dufour B, Martel PO, Simard MJ, Narbonne P. 2025. DAF-18/PTEN prevents oocyte wastage in spermless\n C. elegans\n hermaphrodites by blocking spermatheca neck dilation through RHO-1/RhoA disinhibition. : 10.1101/2025.09.16.676617.
","pubmedId":"","doi":"10.1101/2025.09.16.676617"},{"reference":"Detwiler MR, Reuben M, Li X, Rogers E, Lin R. 2001. Two Zinc Finger Proteins, OMA-1 and OMA-2, Are Redundantly Required for Oocyte Maturation in C. elegans. Developmental Cell 1: 187-199.
","pubmedId":"","doi":"10.1016/s1534-5807(01)00026-0"},{"reference":"Frøkjær-Jensen C, Wayne Davis M, Hopkins CE, Newman BJ, Thummel JM, Olesen SrP, Grunnet M, Jorgensen EM. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics 40: 1375-1383.
","pubmedId":"","doi":"10.1038/ng.248"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Govindan JA, Cheng H, Harris JE, Greenstein D. 2006. Gαo/i and Gαs Signaling Function in Parallel with the MSP/Eph Receptor to Control Meiotic Diapause in C. elegans. Current Biology 16: 1257-1268.
","pubmedId":"","doi":"10.1016/j.cub.2006.05.020"},{"reference":"Govindan JA, Nadarajan S, Kim S, Starich TA, Greenstein D. 2009. Somatic cAMP signaling regulates MSP-dependent oocyte growth and meiotic maturation in C. elegans. Development 136: 2211-2221.
","pubmedId":"","doi":"10.1242/dev.034595"},{"reference":"Hynes TR, Hughes TE, Berlot CH. 2004. Cellular localization of GFP-tagged alpha subunits. Methods Mol Biol 237:233-46. PMID: 14501054.
","pubmedId":"","doi":"10.1385/1-59259-430-1:233"},{"reference":"Kobayashi NR, Hawes SM, Crook JM, Pébay A. 2010. G-protein Coupled Receptors in Stem Cell Self-Renewal and Differentiation. Stem Cell Reviews and Reports 6: 351-366.
","pubmedId":"","doi":"10.1007/s12015-010-9167-9"},{"reference":"Kocsisova Z, Kornfeld K, Schedl T. 2018. Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans. BMC Developmental Biology 18: 10.1186/s12861-018-0171-7.
","pubmedId":"","doi":"10.1186/s12861-018-0171-7"},{"reference":"Korswagen HC, Park JH, Ohshima Y, Plasterk RH. 1997. An activating mutation in a Caenorhabditis elegans Gs protein induces neural degeneration.. Genes & Development 11: 1493-1503.
","pubmedId":"","doi":"10.1101/gad.11.12.1493"},{"reference":"Korta DZ, Tuck S, Hubbard EJA. 2012. S6K links cell fate, cell cycle and nutrient response in C. elegans germline stem/progenitor cells. Development 139(5): 859-70.
","pubmedId":"22278922","doi":""},{"reference":"Kumar S, Olson AC, Koelle MR. 2021. The neural G protein Gαo tagged with GFP at an internal loop is functional in\n Caenorhabditis elegans. G3 Genes|Genomes|Genetics 11: 10.1093/g3journal/jkab167.
","pubmedId":"","doi":"10.1093/g3journal/jkab167"},{"reference":"Layden BT, Newman M, Chen F, Fisher A, Lowe WL. 2010. G Protein Coupled Receptors in Embryonic Stem Cells: A Role for Gs-Alpha Signaling. PLoS ONE 5: e9105.
","pubmedId":"","doi":"10.1371/journal.pone.0009105"},{"reference":"Lee MH, Ohmachi M, Arur S, Nayak S, Francis R, Church D, Lambie E, Schedl T. 2007. Multiple Functions and Dynamic Activation of MPK-1 Extracellular Signal-Regulated Kinase Signaling in Caenorhabditis elegans Germline Development. Genetics 177: 2039-2062.
","pubmedId":"","doi":"10.1534/genetics.107.081356"},{"reference":"Malpe MS, McSwain LF, Kudyba K, Ng CL, Nicholson J, Brady M, Qian Y, Choksi V, Hudson AG, Parrott BB, Schulz C. 2020. G-protein signaling is required for increasing germline stem cell division frequency in response to mating in Drosophila males. Scientific Reports 10: 10.1038/s41598-020-60807-8.
","pubmedId":"","doi":"10.1038/s41598-020-60807-8"},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. The EMBO Journal 10: 3959-3970.
","pubmedId":"","doi":"10.1002/j.1460-2075.1991.tb04966.x"},{"reference":"Mendel JE, Korswagen HC, Liu KS, Hajdu-Cronin YM, Simon MI, Plasterk RHA, Sternberg PW. 1995. Participation of the Protein G\n o\n in Multiple Aspects of Behavior in\n C. elegans. Science 267: 1652-1655.
","pubmedId":"","doi":"10.1126/science.7886455"},{"reference":"Miller MA, Nguyen VQ, Lee MH, Kosinski M, Schedl T, Caprioli RM, Greenstein D. 2001. A Sperm Cytoskeletal Protein That Signals Oocyte Meiotic Maturation and Ovulation. Science 291: 2144-2147.
","pubmedId":"","doi":"10.1126/science.1057586"},{"reference":"Morgan DE, Crittenden SL, Kimble J. 2010. The C. elegans adult male germline: Stem cells and sexual dimorphism. Developmental Biology 346: 204-214.
","pubmedId":"","doi":"10.1016/j.ydbio.2010.07.022"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2015. DAF-18/PTEN locally antagonizes insulin signalling to couple germline stem cell proliferation to oocyte needs in C. elegans. Development : 10.1242/dev.130252.
","pubmedId":"","doi":"10.1242/dev.130252"},{"reference":"Narbonne P, Maddox PS, Labbé JC. 2017. DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation. PLOS Genetics 13: e1006738.
","pubmedId":"","doi":"10.1371/journal.pgen.1006738"},{"reference":"Pedro MP, Lund K, Iglesias-Bartolome R. 2020. The landscape of GPCR signaling in the regulation of epidermal stem cell fate and skin homeostasis. Stem Cells 38: 1520-1531.
","pubmedId":"","doi":"10.1002/stem.3273"},{"reference":"Robinson-Thiewes S, Dufour B, Martel PO, Lechasseur X, Brou AAD, Roy V, Chen Y, Kimble J, Narbonne P. 2021. Non-autonomous regulation of germline stem cell proliferation by somatic MPK-1/MAPK activity in C. elegans. Cell Reports 35: 109162.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109162"},{"reference":"Ségalat L, Elkes DA, Kaplan JM. 1995. Modulation of Serotonin-Controlled Behaviors by G\n o\n in\n Caenorhabditis elegans. Science 267: 1648-1651.
","pubmedId":"","doi":"10.1126/science.7886454"},{"reference":"Seydoux G, Salvage C, Greenwald I. 1993. Isolation and Characterization of Mutations Causing Abnormal Eversion of the Vulva in Caenorhabditis elegans. Developmental Biology 157: 423-436.
","pubmedId":"","doi":"10.1006/DBIO.1993.1146"},{"reference":"Valet M, Narbonne P. 2022. Formation of benign tumors by stem cell deregulation. PLOS Genetics 18: e1010434.
","pubmedId":"","doi":"10.1371/journal.pgen.1010434"},{"reference":"Voutev R, Keating R, Hubbard EJA, Vallier LG. 2008. Characterization of the Caenorhabditis elegans Islet LIM‐homeodomain ortholog, lim‐7. FEBS Letters 583: 456-464.
","pubmedId":"","doi":"10.1016/j.febslet.2008.12.046"}],"title":"The Gα GOA-1/GNAO1 non-autonomously promotes germline stem cell quiescence in feminized C. elegans hermaphrodites from the gonadal sheath cells
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"e90bd484-8b90-4c21-af08-d1253c4e46b1","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}