C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Delhi, DL, India","Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/ba701d9335e2bab666182607e295c72d.png"},"imageCaption":"A. Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of control worm showing gonad (green) and intestine (red). The two ‘U-shaped' gonadal arms are bilaterally symmetric mirror images of each other with one arm passing above the intestine and other below the intestine. Schematic showing regions of C. elegans gonad (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene (4) Diplotene (5) Diakinesis (6) Spermatheca (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm
B. Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null) and toca-2(null);Ppie-1::TOCA-2::GFP animals.
C. Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects.
D. Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents gonad of a single animal.
E. Images depicting gonad development over time in control and toca-2(null) animals. Red filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm
F. Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16): Bottom: the line graph of scatter plot shown above. Error bars indicate standard deviation.
G. Quantification of embryo size in control and toca-2(null) worms.
H. Confocal images indicating progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm
I. Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm.
J. Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm
K. Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium.
L. Contour plots of time averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm).
Statistical significance was determined using Mann -Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::ACT-5] | Lab stock | |
3 | toca-2(ng11)III, toca-1(tm3334)x [Low brood size (~50 eggs) and 10% embryonic lethality] | Alex Hajnal Lab | |
4 | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | CGC | |
5 | This study | ||
6 | This study | ||
7 | jyIs17[vha-6p::mCherry::ACT-5] | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
Description
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1 and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"7e8bf543-10fd-4a18-adae-0485f2e4e5b2","decision":"revise","abstract":"C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Delhi, DL, India","Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/d5de044cfc231dcbf74dc0ce319f74f0.png"},"imageCaption":"A) Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of a control worm showing the gonad (green) and intestine (red). The two ‘U-shaped’ gonadal arms are bilaterally symmetric mirror images of each other, with one arm passing above the intestine and the other below the intestine. Schematic showing regions of C. elegans gonad: (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene, (4) Diplotene, (5) Diakinesis, (6) Spermatheca, (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm. B) Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null), and toca-2(null);Ppie-1::TOCA-2::GFP animals. C) Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects. D) Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents the gonad of a single animal. E) Images depicting gonad development over time in control and toca-2(null) animals. A red-filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm. F) Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16). Bottom: The line graph of the scatter plot shown above. Error bars indicate standard deviation. G) Quantification of embryo size in control and toca-2(null) worms. H) Confocal images indicating the progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm. I) Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm. J) Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm. K) Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium. L) Contour plots of time-averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm). Statistical significance was determined using the Mann-Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
","imageTitle":"TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::ACT-5] | Lab stock | |
3 | toca-2(ng11)III, toca-1(tm3334)x [Low brood size (~50 eggs) and 10% embryonic lethality] | Alex Hajnal Lab | |
4 | ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | CGC | |
5 | This study | ||
6 | This study | ||
7 | jyIs17[vha-6p::mCherry::ACT-5] | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
Description
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1 and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[{"reviewer":{"displayName":"Ariz Mohammad"},"openAcknowledgement":true,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"bd0df3ef-01a9-42a5-8efb-02df3363184e","decision":"edit","abstract":"C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Delhi, DL, India","Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/82b4fde7f950a138f58e5e45a4217e5f.jpeg"},"imageCaption":"A) Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of a control worm showing the gonad (green) and intestine (red). The two ‘U-shaped’ gonadal arms are bilaterally symmetric mirror images of each other, with one arm passing above the intestine and the other below the intestine. Schematic showing regions of C. elegans gonad: (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene, (4) Diplotene, (5) Diakinesis, (6) Spermatheca, (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm. B) Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null), and toca-2(null);Ppie-1::TOCA-2::GFP animals. C) Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects. D) Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents the gonad of a single animal. E) Images depicting gonad development over time in control and toca-2(null) animals. A red-filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm. F) Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16). Bottom: The line graph of the scatter plot shown above. Error bars indicate standard deviation. G) Quantification of embryo size in control and toca-2(null) worms. H) Confocal images indicating the progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm. I) Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm. J) Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm. K) Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium. L) Contour plots of time-averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm). Statistical significance was determined using the Mann-Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
","imageTitle":"TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::act-5] | Lab stock | |
3 | Alex Hajnal Lab | ||
4 | ltIs37 [pie-1p::mCherry::his-58] unc-119(+)] IV; ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | CGC | |
5 | toca-2(ng11)III; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | This study | |
6 | toca-1(tm3334)X; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | This study | |
7 | jyIs17[vha-6p::mCherry::act-5] | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
Description
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1 and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"705f6d1f-b7a0-4b93-a45a-9e39f4ff3506","decision":"edit","abstract":"C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Delhi, DL, India","Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Delhi, DL, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Here is the first part of the fig - to be deleted after review
","doi":null,"resourceType":"Image","name":"Padmanabhan Panels A-E.pdf","url":"https://portal.micropublication.org/uploads/283bdd8822918cf4414bcae4ce2cf9c2.pdf"},{"description":"Here is the second part of the fig - to be deleted after review
","doi":null,"resourceType":"Image","name":"Padmanabhan Panels F-L.pdf","url":"https://portal.micropublication.org/uploads/cd52264221fb1b503f77b6ed25fc65d8.pdf"}],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/82b4fde7f950a138f58e5e45a4217e5f.jpeg"},"imageCaption":"A) Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of a control worm showing the gonad (green) and intestine (red). The two ‘U-shaped’ gonadal arms are bilaterally symmetric mirror images of each other, with one arm passing above the intestine and the other below the intestine. Schematic showing regions of C. elegans gonad: (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene, (4) Diplotene, (5) Diakinesis, (6) Spermatheca, (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm. B) Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null), and toca-2(null);Ppie-1::TOCA-2::GFP animals. C) Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects. D) Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents the gonad of a single animal. E) Images depicting gonad development over time in control and toca-2(null) animals. A red-filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm. F) Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16). Bottom: The line graph of the scatter plot shown above. Error bars indicate standard deviation. G) Quantification of embryo size in control and toca-2(null) worms. H) Confocal images indicating the progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm. I) Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm. J) Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm. K) Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium. L) Contour plots of time-averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm). Statistical significance was determined using the Mann-Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
","imageTitle":"TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::act-5] | Lab stock | |
3 | Alex Hajnal Lab | ||
4 | ltIs37 [pie-1p::mCherry::his-58] unc-119(+)] IV; ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | CGC | |
5 | toca-2(ng11)III; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | This study | |
6 | toca-1(tm3334)X; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | This study | |
7 | jyIs17[vha-6p::mCherry::act-5] | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
Description
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1 and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"9b6ac1fb-8f79-438e-89f9-88846e942127","decision":"accept","abstract":"C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Sonipat, Haryana, India","Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Here is the second part of the fig - to be deleted after review
","doi":null,"resourceType":"Image","name":"Padmanabhan Panels F-L.pdf","url":"https://portal.micropublication.org/uploads/cd52264221fb1b503f77b6ed25fc65d8.pdf"}],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/82b4fde7f950a138f58e5e45a4217e5f.jpeg"},"imageCaption":"A) Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of a control worm showing the gonad (green) and intestine (red). The two ‘U-shaped' gonadal arms are bilaterally symmetric mirror images of each other, with one arm passing above the intestine and the other below the intestine. Schematic showing regions of C. elegans gonad: (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene, (4) Diplotene, (5) Diakinesis, (6) Spermatheca, (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm. B) Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null), and toca-2(null);Ppie-1::TOCA-2::GFP animals. C) Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects. D) Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents the gonad of a single animal. E) Images depicting gonad development over time in control and toca-2(null) animals. A red-filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm. F) Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16). Bottom: The line graph of the scatter plot shown above. Error bars indicate standard deviation. G) Quantification of embryo size in control and toca-2(null) worms. H) Confocal images indicating the progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm. I) Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm. J) Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm. K) Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium. L) Contour plots of time-averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm). Statistical significance was determined using the Mann-Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
","imageTitle":"TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::act-5] | Lab stock | |
3 | Alex Hajnal Lab | ||
4 | ltIs37 [pie-1p::mCherry::his-58] unc-119(+)] IV; ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | CGC | |
5 | toca-2(ng11)III; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | This study | |
6 | toca-1(tm3334)X; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)] | This study | |
7 | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
Description
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1 and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1785522941088"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"e9366ed2-483d-41c2-9819-0e39aac4c4da","decision":"edit","abstract":"C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Sonipat, Haryana, India","Max Planck School Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Here is the second part of the fig - to be deleted after review
","doi":null,"resourceType":"Image","name":"Padmanabhan Panels F-L.pdf","url":"https://portal.micropublication.org/uploads/cd52264221fb1b503f77b6ed25fc65d8.pdf"}],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/82b4fde7f950a138f58e5e45a4217e5f.jpeg"},"imageCaption":"A) Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of a control worm showing the gonad (green) and intestine (red). The two ‘U-shaped' gonadal arms are bilaterally symmetric mirror images of each other, with one arm passing above the intestine and the other below the intestine. Schematic showing regions of C. elegans gonad: (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene, (4) Diplotene, (5) Diakinesis, (6) Spermatheca, (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm. B) Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null), and toca-2(null);Ppie-1::TOCA-2::GFP animals. C) Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects. D) Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents the gonad of a single animal. E) Images depicting gonad development over time in control and toca-2(null) animals. A red-filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm. F) Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16). Bottom: The line graph of the scatter plot shown above. Error bars indicate standard deviation. G) Quantification of embryo size in control and toca-2(null) worms. H) Confocal images indicating the progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm. I) Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm. J) Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm. K) Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium. L) Contour plots of time-averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm). Statistical significance was determined using the Mann-Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
","imageTitle":"TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::act-5] | Lab stock | |
3 | Alex Hajnal Lab | ||
4 | ltIs37 [pie-1p::mCherry::his-58] unc-119(+)] IV; ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | CGC | |
5 | toca-2(ng11)III; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | This study | |
6 | toca-1(tm3334)X; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | This study | |
7 | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1δ. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1δ and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"8ed8a66e-2e47-4d90-85a6-a56a85167e68","decision":"edit","abstract":"C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Sonipat, Haryana, India","Max Planck School Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Here is the second part of the fig - to be deleted after review
","doi":null,"resourceType":"Image","name":"Padmanabhan Panels F-L.pdf","url":"https://portal.micropublication.org/uploads/cd52264221fb1b503f77b6ed25fc65d8.pdf"}],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/8f47ce825e19eedf24bbb492ac84fe6b.jpg"},"imageCaption":"A) Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of a control worm showing the gonad (green) and intestine (red). The two ‘U-shaped' gonadal arms are bilaterally symmetric mirror images of each other, with one arm passing above the intestine and the other below the intestine. Schematic showing regions of C. elegans gonad: (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene, (4) Diplotene, (5) Diakinesis, (6) Spermatheca, (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm. B) Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null), and toca-2(null);Ppie-1::TOCA-2::GFP animals. C) Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects. D) Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents the gonad of a single animal. E) Images depicting gonad development over time in control and toca-2(null) animals. A red-filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm. F) Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16). Bottom: The line graph of the scatter plot shown above. Error bars indicate standard deviation. G) Quantification of embryo size in control and toca-2(null) worms. H) Confocal images indicating the progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm. I) Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm. J) Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm. K) Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium. L) Contour plots of time-averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm). Statistical significance was determined using the Mann-Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
","imageTitle":"TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::act-5] | Lab stock | |
3 | Alex Hajnal Lab | ||
4 | ltIs37 [pie-1p::mCherry::his-58] unc-119(+)] IV; ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | CGC | |
5 | toca-2(ng11)III; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | This study | |
6 | toca-1(tm3334)X; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | This study | |
7 | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1δ. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1δ and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"3c0b3287-bdea-4a1c-b9bb-fd08cfc3899f","decision":"publish","abstract":"C. elegans gonad development and maintenance involve the coordinated integration of biochemical signalling and mechanical forces. Here, we identify a previously unrecognized role for CeTOCA-2, the C. elegans ortholog of mammalian TOCA-1, in maintaining the structural integrity and morphogenesis of the C. elegans gonad. Animals lacking TOCA-2 exhibit pronounced architectural defects, including aberrant gonad morphology, premature distal gonad shrinkage, and disorganized syncytial germline, which alter the spatial patterns of cytoplasmic flow in the syncytium. Our findings establish TOCA-2 as a key regulator of gonad morphogenesis and an important link between cytoskeletal organization and organogenesis in C. elegans.
We acknowledge the infrastructure support from the Central Bio-imaging facility and Ashoka-Zeiss Core Imaging Facility at Ashoka University. We thank Ishani Sharma for her feedback on the manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440).
","authors":[{"affiliations":["Ashoka University, Sonipat, Haryana, India","Max Planck School Matter to Life, Heidelberg, BW, Germany"],"departments":["Department of Biology, Trivedi School of Biosciences",""],"credit":["dataCuration","formalAnalysis","methodology","visualization","writing_originalDraft"],"email":"yogesh.pratap1@alumni.ashoka.edu.in","firstName":"Yogesh","lastName":"Pratap","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-8224-0043"},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["dataCuration","formalAnalysis","methodology","writing_reviewEditing"],"email":"tanushree.sinha_phd24@ashoka.edu.in","firstName":"Tanushree ","lastName":"Sinha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-7405-283X "},{"affiliations":["Ashoka University, Sonipat, Haryana, India"],"departments":["Department of Biology, Trivedi School of Biosciences"],"credit":["conceptualization","fundingAcquisition","methodology","project","resources","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"anup.padmanabhan@ashoka.edu.in","firstName":"Anup","lastName":"Padmanabhan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6007-6929 "}],"awards":[{"awardId":"IA/I/18/1/503624","funderName":"DBT/Wellcome Trust India Alliance (India)","awardRecipient":"Anup Padmanabhan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Here is the second part of the fig - to be deleted after review
","doi":null,"resourceType":"Image","name":"Padmanabhan Panels F-L.pdf","url":"https://portal.micropublication.org/uploads/cd52264221fb1b503f77b6ed25fc65d8.pdf"}],"funding":"This work was supported by DBT-Wellcome India Alliance Fellowship (IA/I/18/1/503624) and ANRF Core research grant (CRG/2023/004638) to A.P, Department of Biotechnology Junior research Fellowship (DBT/2024-25/AshokaUni/2486) to T.S., and core funding support from the Trivedi School of Biosciences, Ashoka University.
","image":{"url":"https://portal.micropublication.org/uploads/ec55fef69caf029d317a071bb36a38d2.jpg"},"imageCaption":"A) Representative image of adult C. elegans gonad morphology in control and toca-2(null) animals. Top: Epifluorescence image of a control worm showing the gonad (green) and intestine (red). The two ‘U-shaped' gonadal arms are bilaterally symmetric mirror images of each other, with one arm passing above the intestine and the other below the intestine. Schematic showing regions of C. elegans gonad: (1) Distal tip cell, (2) progenitor (mitotic cell cycle) zone, (3) Pachytene, (4) Diplotene, (5) Diakinesis, (6) Spermatheca, (7) Embryo within the uterus. Bottom: Images of toca-2(null) gonads showing various morphological defects. Dotted yellow lines represent the curvature of the gonadal arm. Scale bar: 20µm. B) Plot showing the percentage of gonad morphological defects in control, toca-2(null), toca-2(RNAi), toca-2(null);toca-1(null), and toca-2(null);Ppie-1::TOCA-2::GFP animals. C) Quantification of gonad morphology defect types in control and toca-2(RNAi) animals. Bars represent the percentage of animals displaying different types of defects. D) Morphometric quantification of gonad compression and directional defect. Schematic details the measurements used to quantify compression (Rw) and directional displacement (RD), in control and toca-2(RNAi). Each data point represents the gonad of a single animal. E) Images depicting gonad development over time in control and toca-2(null) animals. A red-filled arrowhead indicates the defective gonad in later stages of development in toca-2(null) worms. Scale bar: 50 µm. F) Top: Scatter plot showing quantification of gonad length in control and toca-2(null) worms at 24-hour intervals (n=16). Bottom: The line graph of the scatter plot shown above. Error bars indicate standard deviation. G) Quantification of embryo size in control and toca-2(null) worms. H) Confocal images indicating the progenitor zone (red line) in the gonads of control (n=6) and toca-2(null) (n=12) animals expressing mCherry::HIS-58. Scale bar, 50 µm. I) Confocal images of Phalloidin647 stained distal region of syncytium from control and toca-2(null) animals. Scale bar: 50 µm. J) Particle Image Velocimetry (PIV) analysis of the cytoplasmic flow in control and toca-2(null) syncytium. Scale bar: 10 µm. K) Averaged instantaneous cytoplasmic streaming velocities of all spatial interrogation windows in consecutive frames in control (n=4) and toca-2(null) (n=6) syncytium. L) Contour plots of time-averaged instantaneous velocities across all 210 interrogation windows in the distal gonad arm of control and toca-2(null) animals. PIV was performed using an interrogation window of 32x32 pixels with 50% overlap over an ROI of 282×264 pixels (30.32×28.38 µm). Statistical significance was determined using the Mann-Whitney U test. ****p<0.0001, ***p <0.001, **p <0.01 and * p <0.05.
","imageTitle":"TOCA-2 depletion leads to loss of germline architecture and defective gonad morphology
","methods":"Growth and maintenance of strains
C. elegans and bacterial strains used in this study are listed in Table S1. Primers used to confirm deletion mutants in toca-1 and toca-2 are listed in Table S2. All C. elegans strains were maintained at 20° C on Nematode Growth Medium (NGM) agar plates seeded with E. coli OP50 (Stiernagle, 2006). All bacterial cultures were grown in Luria-Bertani (LB) broth at 37°C at 180 rpm.
RNA interference
RNA interference was performed as previously described (Kamath, 2003), by feeding of the E. coli strain HT115 (DE3) expressing the L4440 plasmid containing toca-2 targeting sequence. HT115 (DE3) containing RNAi clones was cultured in LB broth containing ampicillin (100 μg/mL) and tetracycline (12.5 μg/mL) at 37° C and seeded on to the NGM plate containing 1mM isopropyl β-D-thiogalactoside (IPTG) and 100 μg/mL ampicillin as described previously (Kamath, 2003). HT115(DE3) expressingL4440 (vector alone) was used as the RNAi control. F2 embryos from animals grown on toca-2(RNAi) plates were isolated and allowed to hatch on plates devoid of bacteria. L1-stage synchronized worms were subsequently transferred to toca-2(RNAi) plates for analyzing post embryonic development of germline architecture.
Microscopy
Gonad architecture was imaged using an Olympus BX63 Upright epi-fluorescence microscope. A total of 100 worms were examined from both the mutant and control groups (N2). The worms were mounted on a 3% agarose pad and anesthetized with 0.05% levamisole. Images were acquired using Olympus CellSens Dimension software (version 2.3). Gonad showing significant morphological deviations from wildtype were counted as defective and the proportion of defective animals was compared across conditions using GraphPad prism version 10.6.1.
Mitotic Zone Analysis
Worms were washed in M9 buffer, anesthetized in 0.025% levamisole and were dissected near the pharynx using a hypodermic needle. Extruded gonads were fixed in 2% PFA (Paraformaldehyde) for 15 minutes and imaged on an Olympus IX83 Inverted Microscope (Spinning-disc confocal) and excited at 488 nm and 561 nm laser lines using an OBIS Coherent laser system. The length of the progenitor (mitotic cell cycle) zone on the distal side of the gonad was measured from the distal tip cell (DTC) to the transition zone, characterized by two or more crescent-shaped nuclei in a row.
Particle Image Velocimetry (PIV)
PIV for cytoplasmic flow in distal arm of the gonad was carried out through an ImageJ plugin. Time-lapse DIC videos were recorded for 4 minutes at 2-second intervals (120 frame pairs). PIV was performed on an ROI of size 282×264 pixels (30.32×28.38 µm) using an interrogation window size of 32×32 pixels with 50% overlap, yielding 210 interrogation windows (edge pixels were excluded). Time-averaged velocity was calculated by averaging instantaneous velocities of a single interrogation window across all 120 frame pairs and spatial velocity was calculated by averaging instantaneous velocities across all interrogation windows for a single frame pair.
Statistical Analysis
The Mann-Whitney test and Student's t-test was employed in case of non-normal and normal distributed data, respectively.
","reagents":"Table S1: List of C. elegans strains
S. No. | Strain Name | Genotype | Source |
1 | Scita Lab / Barth Lab | ||
2 | unc-119(ed3)III; ltIs37 IV; ltIs38 + jyIs17[vha-6p::mCherry::act-5] | Lab stock | |
3 | Alex Hajnal Lab | ||
4 | ltIs37 [pie-1p::mCherry::his-58] unc-119(+)] IV; ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | CGC | |
5 | toca-2(ng11)III; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | This study | |
6 | toca-1(tm3334)X; ltIs37 [pie-1p::mCherry::his-58] + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1δ) + unc-119(+)] | This study | |
7 | Lab stock |
Table S2: Primer Sequences used for cloning RNAi feeding constructs
toca-2 forward primer (RZB 276) | GCCACTCGACATCAAGTATAAGAATTC |
toca-2 reverse primer (APO 275) | GATGCGTAAATCGACACATAGCGGTG |
toca-1 forward primer (APO 358) | CGAGCCAGCATCGAGTTGGAG |
toca-1 reverse primer (APO 359) | TCTGATTAACACAAGACTCGGCCTC |
","patternDescription":"
The C. elegans hermaphrodite gonad comprises two symmetrically arranged U-shaped tubes, with one gonad arm positioned above the intestine and the other below it, giving rise to a characteristic ‘hugging' morphology (Hubbard & Greenstein, 2000; McGhee, 2007; Pazdernik & Schedl, 2013). Post-embryonic development of the C. elegans hermaphrodite gonad involves germline proliferation, collective cell migration, differentiation and basement membrane remodelling-processes that require coordinated regulation of cytoskeletal architecture and dynamic reorganization of the extracellular matrix (Agarwal et al., 2022). The TOCA family of proteins regulate membrane-cytoskeleton interactions through specialized functional domains. C. elegans expresses two TOCA-2 paralogs, CeTOCA-1 and CeTOCA-2, that form an autosome/X gene pair (Maciejowski et al., 2005). Germline specific expression of CeTOCA-1 and CeTOCA-2, resulted in their localization to the germline, rachis membranes and early embryos (Giuliani et al., 2009; Nageswaran et al., 2025). Domain analysis revealed that both proteins contain an N-terminal F-BAR domain involved in membrane curvature sensing, an HR1 domain that binds CDC-42, and a C-terminal SH3 domain that interacts with N-WASP. Previous studies have shown that depletion of CeTOCA-2 (hereafter TOCA-2) disrupts clathrin-mediated endocytosis of intestinal yolk uptake into the germline, impairing oocyte maturation and reducing brood size (Giuliani et al., 2009). Furthermore, the genetic null mutant allele, toca-2(ng11) (hereafter toca-2(null)) exhibits increased embryonic lethality due to the gex (gut on the exterior) phenotype (Giuliani et al., 2009; Soto et al., 2002).
To investigate the role of TOCA-2 in gonad morphogenesis and oocyte development, we examined toca-2(RNAi) and toca-2(null) animals co-expressing the intestinal marker ACT-5::mCherry and the germline membrane marker GFP::PHPLC-1δ. Microscopic analysis revealed that depletion of TOCA-2 caused pronounced defects in gonad morphology and architecture (Fig. 1A). Whereas only 6% in control animals displayed abnormal gonad morphology, 36% in toca-2(RNAi) and 56% in toca-2(null) animals had defective gonad architecture (Fig. 1A and 1B). Intriguingly, simultaneous depletion of TOCA-1 and TOCA-2 resulted in 46% of animals displaying gonad defects, suggesting that TOCA-2, rather than TOCA-1, plays a major role in gonad morphogenesis (Fig. 1B). This agrees with the fact that being an autosome/X pair, TOCA-1 is most likely silenced in the germline. Germline-specific expression of GFP-TOCA-2 in toca-2(null) animals partially rescued the phenotype, reducing the frequency of defective gonads from 56% in toca-2(-/-) animals to 24%. To further characterize the observed defects, we classified gonad abnormalities into four major categories; (1) failure of the gonad arms to properly navigate around the intestine, resulting in compression within a restricted region (Intestinal proximity); (2) loss of directional migration in the dorsal arm, leading to aberrant intersections along the dorsoventral (DV) axis (Crossing DV axis); (3) distortion of the characteristic ventral-to-dorsal U-turn (U-turn loop); and, (4) complete disassociation of the gonad from the intestine, disrupting the normal “hugging' morphology (Intestine-gonad dissociation) (Fig. 1C). To quantitively assess the gonad compression, we measured two parameters: normalized gonad width (RW), and normalized dorsal edge displacement from the body wall (RD). TOCA-2 depletion resulted in ~50% reduction in RW and RD, confirming increased gonad compression (Fig.1D).
To investigate the temporal progression of these defects, we monitored gonad development in control, and toca-2(null) animals expressing GFP::PHPLC-1δ and mCherry::HIS-58 in the germline at 24-hour intervals throughout their post-embryonic development. Consistent with previous reports, TOCA-2 depletion resulted in reduced brood size and significantly smaller embryos (Fig. 1E and 1F)(Giuliani et al., 2009). Throughout development, toca-2(null) animals exhibited delayed gonad expansion compared with controls. Interestingly, between 96-120 hours, mutant gonads exhibited pronounced structural defects accompanied by a significant reduction in gonad length compared to controls (Fig. 1F). This shrinkage was largely confined to the distal gonad arm (Fig. 1E, red arrows). The phenotype resembled previously described age-associated gonad atrophy, although it occurred substantially earlier in toca-2(null) animals (Day 4/ 96 hrs) than in wild-type animals (~Day 10 ) (De La Guardia et al., 2016). To determine whether altered germ cell proliferation contributed to impaired gonad elongation, we measured the length of the progenitor zone. However, no significant differences were detected between control and toca-2(null) animals (Fig. 1H), suggesting that impaired germline proliferation is unlikely to account for the reduced gonad length. Similar germline proliferation between control and mutant animals also ruled out excessive germ cell accumulation and subsequent mechanical crumpling as the cause of gonad shrinkage.
TOCA-2 localizes to the partially ingressed rachis membranes and has been implicated in regulating actin dynamics and syncytial organization (Giuliani et al., 2009; Soto et al., 2002). We therefore hypothesized that loss of TOCA-2 disrupts the actomyosin corset surrounding the germline syncytium, thereby altering cytoplasmic flow and compromising tissue integrity. Whole-worm phalloidin staining revealed irregular syncytial morphology in toca-2(null) animals (Fig. 1I). Consistent with this observation, Particle Image Velocimetry (PIV) analysis demonstrated altered cytoplasmic flow patterns in toca-2(null) mutant gonads (Fig. 1J). Although the mean instantaneous velocities were comparable between control and mutant animals, the spatial velocity distribution showed significantly greater variability in toca-2(null) gonads (standard deviation ~8 µm/s in toca-2(null) versus ~5 µm/s in controls) (Fig. 1K). Time-average velocity maps further confirmed this altered flow organization: mutant gonads displayed elevated velocities near the syncytial boundaries, whereas control gonads exhibited smooth decline in velocity from the centre toward the periphery (Fig. 1L). Together these findings suggest that loss of TOCA-2 disrupts actomyosin organization within the germline syncytium, leading to aberrant cytoplasmic flow and defective gonad architecture.
Taken together, our results demonstrate that TOCA-2 is essential for maintaining both the overall morphology of the gonad and internal architecture of the germline syncytium. Germline-specific expression of TOCA-2 is sufficient to substantially rescue morphological defects, indicating a cell-autonomous role in gonad morphogenesis. Beyond its previously established function in clathrin-mediated yolk endocytosis, our findings identify TOCA-2 as a critical regulator of gonad organogenesis and tissue-scale mechanical homeostasis in the C. elegans germline.
","references":[{"reference":"Agarwal P, Shemesh T, Zaidel-Bar R. 2022. Directed cell invasion and asymmetric adhesion drive tissue elongation and turning in C. elegans gonad morphogenesis. Developmental Cell 57: 2111-2126.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2022.08.003"},{"reference":"de la Guardia Y, Gilliat AF, Hellberg J, Rennert P, Cabreiro F, Gems D. 2016. Run-on of germline apoptosis promotes gonad senescence inC. elegans. Oncotarget 7: 39082-39096.
","pubmedId":"","doi":"10.18632/oncotarget.9681"},{"reference":"Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, et al., Scita. 2009. Requirements for F-BAR Proteins TOCA-1 and TOCA-2 in Actin Dynamics and Membrane Trafficking during Caenorhabditis elegans Oocyte Growth and Embryonic Epidermal Morphogenesis. PLoS Genetics 5: e1000675.
","pubmedId":"","doi":"10.1371/journal.pgen.1000675"},{"reference":"Hubbard EJA, Greenstein D. 2000. TheCaenorhabditis elegans gonad: A test tube for cell and developmental biology. Developmental Dynamics 218: 2-22.
","pubmedId":"","doi":"10.1002/(SICI)1097-0177(200005)218:1%3C2::AID-DVDY2%3E3.0.CO;2-W"},{"reference":"Kamath R. 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods 30: 313-321.
","pubmedId":"","doi":"10.1016/S1046-2023(03)00050-1"},{"reference":"Maciejowski J, Ahn JH, Cipriani PG, Killian DJ, Chaudhary AL, Lee JI, et al., Hubbard. 2005. Autosomal Genes of Autosomal/X-Linked Duplicated Gene Pairs and Germ-Line Proliferation in Caenorhabditis elegans. Genetics 169: 1997-2011.
","pubmedId":"","doi":"10.1534/genetics.104.040121"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Nageswaran A, Mitra P, Rai M, Anand D, Pratap Y, Padmanabhan A. 2025. ARP2/3 regulates cell surface dynamics of CeTOCA-1 in C. elegans zygotes. J Biosci 50: pii: 40.
","pubmedId":"40501091","doi":""},{"reference":"Pazdernik N, Schedl T. 2012. Introduction to Germ Cell Development in Caenorhabditis elegans. Advances in Experimental Medicine and Biology,Germ Cell Development in C. elegans : 1-16.
","pubmedId":"","doi":"10.1007/978-1-4614-4015-4_1"},{"reference":"Soto MC, Qadota H, Kasuya K, Inoue M, Tsuboi D, Mello CC, Kaibuchi K. 2002. The GEX-2 and GEX-3 proteins are required for tissue morphogenesis and cell migrations in\n C. elegans. Genes & Development 16: 620-632.
","pubmedId":"","doi":"10.1101/gad.955702"},{"reference":"Stiernagle T. 2006. Maintenance of C. elegans. WormBook : 10.1895/wormbook.1.101.1.
","pubmedId":"","doi":"10.1895/wormbook.1.101.1"}],"title":"TOCA-2 regulates gonad development in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1785904716623"}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"580d1a3a-e796-489f-a69d-fc3c86db8325","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}