Laboratory cultivation imposes selective pressures that drive rapid bacterial evolution, compromising experimental reproducibility. We investigated phenotypic and genomic divergence in two Rhodospirillum rubrum S1 strains originally obtained from the same collection. Both strains harbored shared deviations from the reference genome. The recently acquired strain exhibited few additional mutations, including a fliF frameshift abolishing motility. The second, long-maintained strain, by contrast, was motile but possessed numerous unique variations, particularly within stress-responsive histidine kinases. Thus, routine passaging and cultivation practices facilitate rapid genomic drift in R. rubrum, highlighting the need for immediate cryopreservation and minimal serial cultivation to maintain genomic integrity.
","acknowledgements":"We thank Dirk Schüler for providing his R. rubrum S1 laboratory strain, and Doreen Meier and Marta Pulido Sánchez for their assistance with the deposition of the genomic sequencing data. We are also grateful to Frank-Dietrich Müller, Hartmut Grammel and Reinhard Bachofen for their help in reconstructing the historical lineage of the DS strain.
","authors":[{"affiliations":["Marburg University, Marburg, Germany","Marburg, Germany"],"departments":["Department of Biology","Center for Synthetic Microbiology (SYNMIKRO)"],"credit":["conceptualization","dataCuration","formalAnalysis","investigation","methodology","visualization","writing_originalDraft"],"email":"sebastian.poehl@biologie.uni-marburg.de","firstName":"Sebastian","lastName":"Pöhl","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-6612-4340"},{"affiliations":["Max Planck Institute for Terrestrial Microbiology, Marburg, Germany"],"departments":["Department of Natural Products in Organismic Interactions"],"credit":["methodology"],"email":"anke.treunerLange@mpi-marburg.mpg.de","firstName":"Anke","lastName":"Treuner-Lange","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6435-5642"},{"affiliations":["Marburg University, Marburg, Germany","Marburg, Germany"],"departments":["Department of Biology","Center for Synthetic Microbiology (SYNMIKRO)"],"credit":["conceptualization","fundingAcquisition","investigation","project","supervision","writing_originalDraft"],"email":"thanbichler@uni-marburg.de","firstName":"Martin","lastName":"Thanbichler","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1303-1442"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"This spreadsheet details both the shared and unique variants identified across both strains, alongside quality control metrics for the underlying sequencing data. Additionally, it specifies the affected open reading frames (ORFs) and the predicted functional annotations of the encoded proteins (XLSX file; Microsoft Excel).
","doi":null,"resourceType":"Dataset","name":"Extended Data.xlsx","url":"https://portal.micropublication.org/uploads/cd49c89766674b157f4bdd201e048838.xlsx"}],"funding":"This work was supported by Marburg University (core funding to M.T.) and the Max Planck Society (core funding to A.T.-L.).
","image":{"url":"https://portal.micropublication.org/uploads/1f11f37803b9d5a20f414aecc3e0de54.png"},"imageCaption":"(a) Transmission electron micrographs showing representative cells of the R. rubrum S1 MT and DS strains, alongside a derivative of the MT strain (SP343), in which the frameshift mutation in fliF was corrected to restore the wild-type fliF allele matching the R. rubrum S1 reference genome sequence. Bar: 1 µm. Arrowheads indicate attached and sheared flagella. (b) Schematic mapping of unique and shared genomic deviations in the MT and DS laboratory strains relative to the R. rubrum S1 reference genome (ATCC 11170). The position of the frameshift mutation in fliF is indicated. Due to the close proximity of certain mutations, individual bars may indicate multiple closely spaced genomic variants. (c) Summary of unique and shared genomic variants in the two laboratory strains. Mixed variants are defined as loci where more than 25% of the reads support the reference genome sequence. Details are provided in the Extended Data file.
","imageTitle":"Comparison of R. rubrum S1 laboratory strains
","methods":"Growth conditions. For the preparation of genomic DNA, the variants of R. rubrum S1 (DSM 467) (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) investigated in this study were grown to exponential phase in the dark at 28 °C in liquid Tryptic Soy (TS) medium (1.7 % tryptone, 0.3% soytone, 0.25% dextrose, 0.5% NaCl, 0.25% K2HPO4) shaking at 210 rpm. To visualize flagella, cells were grown in a MIR-154 daylight-incubator (Panasonic, Japan) at 28 °C in liquid YPS medium (0.3% yeast extract, 0.3% peptone, 1 mM CaCl2, 1 mM MgSO4) rotating at 20 rpm in Falcon tubes under microoxic conditions (14 ml culture in closed 15 ml Falcon tubes).
Plasmid and strain construction. The bacterial strains, plasmids and oligonucleotides used in this study are listed in the Reagents section. To construct plasmid pSP250, used to reverse the frameshift mutation in the fliF gene, the regions flanking base pair 642,095 of the R. rubrum S1 MT laboratory strain chromosome were PCR-amplified using primer pairs oSP895/oSP896 and oSP897/oSP898. The amplification product, which carried a single-base-pair deletion that removed the insertion disrupting the fliF reading frame, was cloned into the sacB-containing allelic replacement vector pNPTS138 (M.R.K. Alley, unpublished) via Gibson assembly, using HindIII- and NheI-digested vector DNA (Gibson et al., 2009) and E. coli TOP10 (Thermo Fisher Scientific, USA) as the cloning host. The resulting plasmid was verified by DNA sequencing. To construct the fliF revertant SP343, the MT strain was transformed with plasmid pSP250 via conjugation, employing the donor strain E. coli WM3064 (Pöhl et al., 2024). Single integrants were subjected to allelic replacement based on sucrose counterselection to select for a second recombination event (Cserti et al., 2017; Jung et al., 2015). Clones that had undergone double homologous recombination, thereby restoring the wild-type fliF allele, were identified by colony PCR, followed by sequencing of the PCR products.
Transmission electron microscopy. Cells were grown under microoxic conditions at 28 °C in liquid YPS medium to an OD600 of 0.4, harvested by centrifugation for 3 min at 2500 xg, and then resuspended in the same, the 0.05-fold or the 0.0125-fold volume in fresh YPS medium, using plastic tips with cut-off tips to avoid the shearing of flagella. For imaging, 50 μl aliquots of the samples were transferred to parafilm. Subsequently, glow-discharged carbon-coated copper 300 mesh grids were placed upside-down on top of the sample (S162-3; Plano Wetzlar, Germany). After 10 min of incubation, the grids were washed twice with water and treated for 10 sec with 2% (w/v) uranyl acetate. Micrographs were taken with a JEM-1400 transmission electron microscope (JEOL, Japan) at an acceleration voltage of 100 kV. Fiji 1.54f (Schindelin et al., 2012) was used for data analysis.
Genome sequencing and comparison. Genomic DNA was purified with the NucleoSpin® Microbial DNA kit (Macherey-Nagel, Germany; Ref: 740235) according to the manufacturer’s instructions. Bacterial genome sequencing was performed by Plasmidsaurus (Louisville, KY, USA) integrating long-read Oxford Nanopore and short-read Illumina sequencing technologies, followed by custom analysis and annotation (Supplementary Data). Clair3 (Zheng et al., 2022) was used to compare the genomes obtained to the R. rubrum S1 reference sequence (GenBank accession no. NC_007643.1; Munk et al., 2011) and identify SNPs and small indels.
Availability of biological material. The bacterial strains used in this study are available from the corresponding author upon request.
Data availability. The genome sequences of the two R. rubrum S1 laboratory strains analyzed in this study have been deposited to the European Nucleotide Archive (ENA) with the dataset identifier PRJEB114701 [https://www.ebi.ac.uk/ena/browser/view/PRJEB114701]. All other data generated in this study are included in the manuscript or the Extended Data file.
","reagents":"Strains
Strain | History/genotype | Source |
Rhodospirillum rubrum S1 (DSM 467) | This strain is the neotype strain of R. rubrum provided by the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DMSZ, Germany) under catalogue number DSM 467. DMSZ originally obtained the culture from the American Type Culture Collection (ex ATCC 11170). A comparison of its DSM catalogue number to nearby entries suggests an acquisition date between 1973 and 1974. | DSMZ |
Rhodospirillum rubrum S1 (MT strain)
| The strain was obtained from the DSMZ in 2017 as a lyophilized sample under catalogue number DSM 467. The cells were resuspended and revived in tryptic soy (TS) medium prior to direct storage as a master cryostock. | DSMZ |
Rhodospirillum rubrum S1 (DS strain) | The DS strain was obtained in the early 2020s from Hartmut Grammel (Hochschule Biberach, Germany), who had received it from Robin Ghosh (University of Stuttgart, Germany) in the early 2010s. Ghosh, who has published research on this strain since 1993, originally acquired it from Reinhard Bachofen (University of Zurich, Switzerland). Bachofen initiated his work on this specific lineage in 1964. Since the original culture was sourced prior to the establishment of the DSMZ, it probably tracks back to the original ATCC 11170 repository stock (personal communication with H. Grammel and R. Bachofen). | Dirk Schüler (University of Bayreuth, Germany) |
Rhodosprillum rubrum SP343 | Derivative of the R. rubrum S1 MT laboratory strain carrying the wild-type fliF allele | This study |
Escherichia coli TOP10 | F– mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG | Thermo Fisher Scientific |
Escherichia coli WM3064 | thrB1004 pro thi rpsL hsdS lacZΔM15 RP4–1360 Δ(araBAD)567 ΔdapA1341::[erm pir(wt)] | W. Metcalf, unpublished |
Plasmids
Designation | Description | Source |
pNPTS138 | sacB‐containing suicide vector used for double homologous recombination, pUC ori, KanR | M.R.K. Alley, unpublished |
pSP250 | pNPTS138 derivative used to restore the wild-type fliF allele in the MT strain by double homologous recombination | This study |
Primers
Designation | Sequence (5′ to 3′) | Source |
oSP895 | GCAATTGAAGCCGGCTGGCGCCAGAACTGCATGTTCACCACTTCGATC | This study |
oSP896 | CATCCAGGGGGTGGAGGGCGCCCGCG | This study |
oSP897 | GCGCCCTCCACCCCCTGGATGGTGCGCACG | This study |
oSP898 | CCGGAGACGCGTCACGGCCGAAGCCGCGAAGTCCAGAAGGGCG | This study |
Culture collections and research laboratories typically subject bacterial strains to periodic cycles of revival and re-preservation to ensure long-term viability. However, serial passaging can introduce spontaneous mutations that are propagated through subsequent generations (Marks et al., 2010; Kram et al., 2017; Knöppel et al., 2018; Ratib et al., 2021). When such mutations confer a selective fitness advantage under laboratory conditions, genomic variants can rapidly dominate the population, leading to significant evolutionary divergence from the progenitor strain. This genetic drift may compromise experimental reproducibility and invalidate comparisons against established reference genomes.
As a case in point, while studying cell morphogenesis in the spiral-shaped bacterium Rhodospirillum rubrum S1 (Pöhl et al., 2024) – the type strain of the species Rhodospirillum (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) – we observed that a culture of this strain originally acquired from the Leibniz Institute DMSZ (Germany) in 2016 under catalogue number DSM 467 lacked its previously reported flagella-mediated swimming motility (Lee & Fitzsimons, 1976). The strain was obtained in a lyophilized state, revived in liquid medium, and immediately preserved in our laboratory strain collection as a cryostock (hereafter referred to as the MT strain) to minimize genetic divergence from the repository reference. Importantly, a culture newly obtained from the DSMZ in 2026 displayed the same non-motile phenotype, confirming that this defect did not arise spontaneously during laboratory handling or cryopreservation. By contrast, normal swimming behavior was observed for a widely studied R. rubrum S1 laboratory lineage provided by the research group of Dirk Schüler (University of Bayreuth, Germany) that was likely sourced from the American Type Culture Collection in the mid-1960s (hereafter referred to as the DS strain). In line with these observations, transmission electron microscopy revealed that the MT strain failed to assemble flagellar filaments, whereas the DS strain showed the characteristic monopolar or bipolar flagellation pattern documented in the literature (Figure 1a; Lee & Fitzsimons, 1976). To identify the genetic basis of this phenotypic difference, we sequenced the genomes of both laboratory strains and compared them to the R. rubrum S1 reference genome (Munk et al., 2011), which is derived from an R. rubrum S1 stock deposited at the American Type Culture Collection (ATCC 11170).
Comparative sequence analysis revealed that both strains deviated from the reference genome at multiple loci (Figure 1b,c). A subset of these variations was strain-specific, whereas 18 mutations were shared, suggesting that genetic drift had already commenced within the culture collection prior to further divergence of the strains during independent maintenance in the respective laboratories. The shared deviations comprise 10 single nucleotide polymorphisms (SNPs). Five are located in intergenic regions, while the remaining five introduce non-synonymous mutations in predicted open reading frames (ORFs), resulting in amino acid substitutions in the putative gene products (see Extended Data). Both strains additionally harbor insertions and deletions that disrupt ORF Rru_A0205 (DnaJ-like protein), fuse Rru_A0341 (CRISPR-associated protein) with Rru_A0342 (uncharacterized), extend the reading frame of Rru_A2352 (uncharacterized) and fuse Rru_A2834 (uncharacterized) with Rru_A2835 (MotB-like protein).
Beyond the shared deviations, the genome of the MT strain exhibited seven unique differences relative to the reference sequence (Figure 1b,c). Six of these are SNPs located either in intergenic regions or within ORFs, where they result in amino acid substitutions. The remaining deviation was a single base-pair insertion within the gene for the flagellar MS-ring protein FliF (Homma et al., 1987; Ueno et al., 1992), which leads to a shift in the reading frame, thereby disrupting FliF function. The MS-ring forms the foundation of the bacterial flagellum, anchoring the motor in the inner membrane and serving as the base for the assembly of structural components such as the flagellar rod and filament (Francis et al., 1992; Kubori et al., 1992; Ueno et al., 1994). The disruption of fliF in the MT strain thus disrupts flagellar biogenesis, in agreement with the lack of flagella observed by electron microscopy (Figure 1a). Notably, flagellar assembly and motility were fully restored by reverting the frame shift mutation in fliF back to the reference genome sequence (Figure 1a), confirming the absence of other mutations deleterious to flagellar motility.
As expected, the DS strain did not show any mutations in motility-related genes, but it stood out due to its high frequency of unique deviations from the reference genome (Figure 1b,c). In total, the strain harbors 79 unique SNPs, with 11 located in intergenic regions and 68 within open reading frames (ORFs). While the majority of the latter result in silent or non-synonymous mutations, three have more severe functional consequences: two introduce nonsense mutations that truncate Rru_A1282 (a VirG-like protein) and Rru_A1603 (a PhoH-like protein), while the third disrupts the start codon of Rru_A2703 (a TrmH-like protein), thereby precluding the formation of the gene product. In addition to SNPs, the DS strain harbors 3 unique deletions, which shorten ORFs Rru_A0918 (histidine kinase) and Rru_A3395 (LuxR-like transcriptional regulator) and introduce a frameshift in Rru_A1277 (histidine kinase), completely disrupting its function. Furthermore, the strain exhibits 4 unique insertions. One is located in an intergenic region, while two others induce frameshifts that disrupt Rru_A1034 (a histidine kinase) and Rru_A1843 (an OmpA/MotB-like protein). Finally, the DS strain is characterized by a 1,416 bp insertion within Rru_A2108 (a histidine kinase). This segment exhibits high similarity (93% coverage; 73.56% identity; E-value 2E-125) to a genomic region in Pararhodospirillum photometricum DSM 122 (positions 1,859,748–1,861,060), suggesting that it was acquired via horizontal gene transfer.
Collectively, these findings illustrate the rapid pace of bacterial genome evolution under laboratory conditions. Common cultivation practices subject bacteria to various selective pressures, such as the demand for rapid planktonic growth in rich media under fixed environmental conditions, the need to withstand extended incubation in stationary phase on nutrient agar plates, and the requirement to survive prolonged cooling and repeated freeze-thaw cycles during strain maintenance. Adaptive mutations can rapidly accumulate during these stress phases and become fixed in subsequent generations. Consistent with this notion, both laboratory strains accumulated mutations in transcriptional regulators and histidine kinases, which are critical for environmental stress sensing and adaptation. To mitigate the selection of genomic variants, new strains should be cryopreserved at the earliest opportunity after their isolation, keeping the number of serial passages to a minimum. Moreover, practices such as the long-term storage of cultures in stationary phase at room temperature, which are still commonly encountered for photosynthetic bacteria, should be strictly avoided.
Our data demonstrate that, despite sharing the same origin, R. rubrum S1 laboratory and repository strains commonly used in research and biotechnology have diverged significantly over the past decades. The variations in their genomic sequences represent a critical factor that should be carefully considered when comparing experimental results obtained with strains from different lineages.
","references":[{"reference":"Cserti Ek, Rosskopf S, Chang YW, Eisheuer S, Selter L, Shi J, et al., Thanbichler. 2017. Dynamics of the peptidoglycan biosynthetic machinery in the stalked budding bacterium Hyphomonas neptunium. Molecular Microbiology 103: 875-895.
","pubmedId":"","doi":"10.1111/mmi.13593"},{"reference":"Francis NR, Irikura VM, Yamaguchi S, DeRosier DJ, Macnab RM. 1992. Localization of the Salmonella typhimurium flagellar switch protein FliG to the cytoplasmic M-ring face of the basal body. Proceedings of the National Academy of Sciences USA 89: 6304-6308.
","pubmedId":"","doi":"10.1073/PNAS.89.14.6304"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Homma M, Aizawa S, Dean GE, Macnab RM. 1987. Identification of the M-ring protein of the flagellar motor of Salmonella typhimurium. Proceedings of the National Academy of Sciences USA 84: 7483-7487.
","pubmedId":"","doi":"10.1073/PNAS.84.21.7483"},{"reference":"Jung A, Eisheuer S, Cserti Ek, Leicht O, Strobel W, Möll A, et al., Thanbichler. 2015. Molecular toolbox for genetic manipulation of the stalked budding bacterium Hyphomonas neptunium. Applied and Environmental Microbiology 81: 736-744.
","pubmedId":"","doi":"10.1128/AEM.03104-14"},{"reference":"Knöppel A, Knopp M, Albrecht LM, Lundin E, Lustig U, Näsvall J, Andersson DI. 2018. Genetic adaptation to growth under laboratory conditions in Escherichia coli and Salmonella enterica. Frontiers in Microbiology 9: 10.3389/fmicb.2018.00756.
","pubmedId":"","doi":"10.3389/FMICB.2018.00756"},{"reference":"Kram KE, Geiger C, Ismail WM, Lee H, Tang H, Foster PL, Finkel SE. 2017. Adaptation of Escherichia coli to long-term serial passage in complex medium: evidence of parallel evolution. mSystems 2: 10.1128/msystems.00192-16.
","pubmedId":"","doi":"10.1128/MSYSTEMS.00192-16"},{"reference":"Kubori T, Shimamoto N, Yamaguchi S, Namba K, Aizawa SI. 1992. Morphological pathway of flagellar assembly in Salmonella typhimurium. Journal of Molecular Biology 226: 433-446.
","pubmedId":"","doi":"10.1016/0022-2836(92)90958-M"},{"reference":"Lee AG, Fitzsimons JTR. 1976. Motility in normal and filamentous forms of Rhodospirillum rubrum. Journal of General Microbiology 93: 346-354.
","pubmedId":"","doi":"10.1099/00221287-93-2-346"},{"reference":"Marks ME, Castro-Rojas CM, Teiling C, Du L, Kapatral V, Walunas TL, Crosson S. 2010. The genetic basis of laboratory adaptation in Caulobacter crescentus. Journal of Bacteriology 192: 3678-3688.
","pubmedId":"","doi":"10.1128/JB.00255-10"},{"reference":"Molisch H (1907) Die Purpurbakterien nach neuen Untersuchungen I-VII. Gustav Fischer, Jena.
","pubmedId":"","doi":""},{"reference":"Munk AC, Copeland A, Lucas S, Lapidus A, Del Rio TG, Barry K, et al., Schwartz. 2011. Complete genome sequence of Rhodospirillum rubrum type strain (S1T). Standards in Genomic Sciences 4: 293-302.
","pubmedId":"","doi":"10.4056/sigs.1804360"},{"reference":"van Niel CB. 1944. The culture, general physiology, morphology, and classification of the non-sulfur purple and brown bacteria. Bacteriological Reviews 8: 1-118.
","pubmedId":"","doi":"10.1128/br.8.1.1-118.1944"},{"reference":"Pfennig N, Trüper HG. 1971. Type and neotype strains of the species of phototrophic bacteria maintained in pure culture. International Journal of Systematic Bacteriology 21: 19-24.
","pubmedId":"","doi":"10.1099/00207713-21-1-19"},{"reference":"Pöhl S, Giacomelli G, Meyer FM, Kleeberg V, Cohen EJ, Biboy J, et al., Thanbichler. 2024. An outer membrane porin-lipoprotein complex modulates elongasome movement to establish cell curvature in Rhodospirillum rubrum. Nature Communications 15: 10.1038/s41467-024-51790-z.
","pubmedId":"","doi":"10.1038/s41467-024-51790-z"},{"reference":"Ratib NR, Seidl F, Ehrenreich IM, Finkel SE. 2021. Evolution in long-term stationary-phase batch culture: emergence of divergent Escherichia coli lineages over 1,200 days. mBio 12: 10.1128/mbio.03337-20.
","pubmedId":"","doi":"10.1128/MBIO.03337-20"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1992. M ring, S ring and proximal rod of the flagellar basal body of Salmonella typhimurium are composed of subunits of a single protein, FliF. Journal of Molecular Biology 227: 672-677.
","pubmedId":"","doi":"10.1016/0022-2836(92)90216-7"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1994. Domain structures of the MS ring component protein (FliF) of the flagellar basal body of Salmonella typhimurium. Journal of Molecular Biology 236: 546-555.
","pubmedId":"","doi":"10.1006/JMBI.1994.1164"},{"reference":"Zheng Z, Li S, Su J, Leung AWS, Lam TW, Luo R. 2022. Symphonizing pileup and full-alignment for deep learning-based long-read variant calling. Nature Computational Science 2: 797-803.
","pubmedId":"","doi":"10.1038/s43588-022-00387-x"}],"title":"Genome sequencing of Rhodospirillum rubrum S1 strains reveals significant differences to the reference genome
","reviews":[],"curatorReviews":[]},{"id":"0bfe9bfe-1593-4e20-87f7-08ae0217bcb9","decision":"revise","abstract":"Laboratory cultivation imposes selective pressures that drive rapid bacterial evolution, compromising experimental reproducibility. We investigated phenotypic and genomic divergence in two Rhodospirillum rubrum S1 strains originally obtained from the same collection. Both strains harbored shared deviations from the reference genome. The recently acquired strain exhibited few additional mutations, including a fliF frameshift abolishing motility. The second, long-maintained strain, by contrast, was motile but possessed numerous unique variations, particularly within stress-responsive histidine kinases. Thus, routine passaging and cultivation practices facilitate rapid genomic drift in R. rubrum, highlighting the need for immediate cryopreservation and minimal serial cultivation to maintain genomic integrity.
","acknowledgements":"We thank Dirk Schüler for providing his R. rubrum S1 laboratory strain, and Doreen Meier and Marta Pulido Sánchez for their assistance with the deposition of the genomic sequencing data. We are also grateful to Frank-Dietrich Müller, Hartmut Grammel and Reinhard Bachofen for their help in reconstructing the historical lineage of the DS strain.
","authors":[{"affiliations":["Marburg University, Marburg, Germany","Marburg, Germany"],"departments":["Department of Biology","Center for Synthetic Microbiology (SYNMIKRO)"],"credit":["conceptualization","dataCuration","formalAnalysis","investigation","methodology","visualization","writing_originalDraft"],"email":"sebastian.poehl@biologie.uni-marburg.de","firstName":"Sebastian","lastName":"Pöhl","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-6612-4340"},{"affiliations":["Max Planck Institute for Terrestrial Microbiology, Marburg, Germany"],"departments":["Department of Natural Products in Organismic Interactions"],"credit":["methodology"],"email":"anke.treunerLange@mpi-marburg.mpg.de","firstName":"Anke","lastName":"Treuner-Lange","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6435-5642"},{"affiliations":["Marburg University, Marburg, Germany","Marburg, Germany"],"departments":["Department of Biology","Center for Synthetic Microbiology (SYNMIKRO)"],"credit":["conceptualization","fundingAcquisition","investigation","project","supervision","writing_originalDraft"],"email":"thanbichler@uni-marburg.de","firstName":"Martin","lastName":"Thanbichler","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1303-1442"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"This spreadsheet details both the shared and unique variants identified across both strains, alongside quality control metrics for the underlying sequencing data. Additionally, it specifies the affected open reading frames (ORFs) and the predicted functional annotations of the encoded proteins (XLSX file; Microsoft Excel).
","doi":null,"resourceType":"Dataset","name":"Extended Data.xlsx","url":"https://portal.micropublication.org/uploads/cd49c89766674b157f4bdd201e048838.xlsx"}],"funding":"This work was supported by Marburg University (core funding to M.T.) and the Max Planck Society (core funding to A.T.-L.).
","image":{"url":"https://portal.micropublication.org/uploads/6b01f8925393083e1879d7dc278d6a31.png"},"imageCaption":"(a) Transmission electron micrographs showing representative cells of the R. rubrum S1 MT and DS strains, alongside a derivative of the MT strain (SP343), in which the frameshift mutation in fliF was corrected to restore the wild-type fliF allele matching the R. rubrum S1 reference genome sequence. Bar: 1 µm. Arrowheads indicate attached and sheared flagella. (b) Schematic mapping of unique and shared genomic deviations in the MT and DS laboratory strains relative to the R. rubrum S1 reference genome (ATCC 11170). The position of the frameshift mutation in fliF is indicated. Due to the close proximity of certain mutations, individual bars may indicate multiple closely spaced genomic variants. (c) Summary of unique and shared genomic variants in the two laboratory strains. Mixed variants are defined as loci where more than 25% of the reads support the reference genome sequence. Details are provided in the Extended Data file.
","imageTitle":"Comparison of R. rubrum S1 laboratory strains
","methods":"Growth conditions. For the preparation of genomic DNA, the variants of R. rubrum S1 (DSM 467) (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) investigated in this study were grown to exponential phase in the dark at 28 °C in liquid Tryptic Soy (TS) medium (1.7 % tryptone, 0.3% soytone, 0.25% dextrose, 0.5% NaCl, 0.25% K2HPO4) shaking at 210 rpm. To visualize flagella, cells were grown in a MIR-154 daylight-incubator (Panasonic, Japan) at 28 °C in liquid YPS medium (0.3% yeast extract, 0.3% peptone, 1 mM CaCl2, 1 mM MgSO4) rotating at 20 rpm in Falcon tubes under microoxic conditions (14 ml culture in closed 15 ml Falcon tubes).
Plasmid and strain construction. The bacterial strains, plasmids and oligonucleotides used in this study are listed in the Reagents section. To construct plasmid pSP250, used to reverse the frameshift mutation in the fliF gene, the regions flanking base pair 642,095 of the R. rubrum S1 MT laboratory strain chromosome were PCR-amplified using primer pairs oSP895/oSP896 and oSP897/oSP898. The amplification product, which carried a single-base-pair deletion that removed the insertion disrupting the fliF reading frame, was cloned into the sacB-containing allelic replacement vector pNPTS138 (M.R.K. Alley, unpublished) via Gibson assembly, using HindIII- and NheI-digested vector DNA (Gibson et al., 2009) and E. coli TOP10 (Thermo Fisher Scientific, USA) as the cloning host. The resulting plasmid was verified by DNA sequencing. To construct the fliF revertant SP343, the MT strain was transformed with plasmid pSP250 via conjugation, employing the donor strain E. coli WM3064 (Pöhl et al., 2024). Single integrants were subjected to allelic replacement based on sucrose counterselection to select for a second recombination event (Cserti et al., 2017; Jung et al., 2015). Clones that had undergone double homologous recombination, thereby restoring the wild-type fliF allele, were identified by colony PCR, followed by sequencing of the PCR products.
Transmission electron microscopy. Cells were grown under microoxic conditions at 28 °C in liquid YPS medium to an OD600 of 0.4, harvested by centrifugation for 3 min at 2500 xg, and then resuspended in the same, the 0.05-fold or the 0.0125-fold volume in fresh YPS medium, using plastic tips with cut-off tips to avoid the shearing of flagella. For imaging, 50 μl aliquots of the samples were transferred to parafilm. Subsequently, glow-discharged carbon-coated copper 300 mesh grids were placed upside-down on top of the sample (S162-3; Plano Wetzlar, Germany). After 10 min of incubation, the grids were washed twice with water and treated for 10 sec with 2% (w/v) uranyl acetate. Micrographs were taken with a JEM-1400 transmission electron microscope (JEOL, Japan) at an acceleration voltage of 100 kV. Fiji 1.54f (Schindelin et al., 2012) was used for data analysis.
Genome sequencing and comparison. Genomic DNA was purified with the NucleoSpin® Microbial DNA kit (Macherey-Nagel, Germany; Ref: 740235) according to the manufacturer’s instructions. Bacterial genome sequencing was performed by Plasmidsaurus (Louisville, KY, USA) integrating long-read Oxford Nanopore and short-read Illumina sequencing technologies, followed by custom analysis and annotation (Supplementary Data). Clair3 (Zheng et al., 2022) was used to compare the genomes obtained to the R. rubrum S1 reference sequence (GenBank accession no. NC_007643.1; Munk et al., 2011) and identify SNPs and small indels.
Availability of biological material. The bacterial strains used in this study are available from the corresponding author upon request.
Data availability. The genome sequences of the two R. rubrum S1 laboratory strains analyzed in this study have been deposited to the European Nucleotide Archive (ENA) with the dataset identifier PRJEB114701 [https://www.ebi.ac.uk/ena/browser/view/PRJEB114701]. All other data generated in this study are included in the manuscript or the Extended Data file.
","reagents":"Strains
Strain | History/genotype | Source |
Rhodospirillum rubrum S1 (DSM 467) | This strain is the neotype strain of R. rubrum provided by the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DMSZ, Germany) under catalogue number DSM 467. DMSZ originally obtained the culture from the American Type Culture Collection (ex ATCC 11170). A comparison of its DSM catalogue number to nearby entries suggests an acquisition date between 1973 and 1974. | DSMZ |
Rhodospirillum rubrum S1 (MT strain)
| The strain was obtained from the DSMZ in 2017 as a lyophilized sample under catalogue number DSM 467. The cells were resuspended and revived in tryptic soy (TS) medium prior to direct storage as a master cryostock. | DSMZ |
Rhodospirillum rubrum S1 (DS strain) | The DS strain was obtained in the early 2020s from Hartmut Grammel (Hochschule Biberach, Germany), who had received it from Robin Ghosh (University of Stuttgart, Germany) in the early 2010s. Ghosh, who has published research on this strain since 1993, originally acquired it from Reinhard Bachofen (University of Zurich, Switzerland). Bachofen initiated his work on this specific lineage in 1964. Since the original culture was sourced prior to the establishment of the DSMZ, it probably tracks back to the original ATCC 11170 repository stock (personal communication with H. Grammel and R. Bachofen). | Dirk Schüler (University of Bayreuth, Germany) |
Rhodosprillum rubrum SP343 | Derivative of the R. rubrum S1 MT laboratory strain carrying the wild-type fliF allele | This study |
Escherichia coli TOP10 | F– mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG | Thermo Fisher Scientific |
Escherichia coli WM3064 | thrB1004 pro thi rpsL hsdS lacZΔM15 RP4–1360 Δ(araBAD)567 ΔdapA1341::[erm pir(wt)] | W. Metcalf, unpublished |
Plasmids
Designation | Description | Source |
pNPTS138 | sacB‐containing suicide vector used for double homologous recombination, pUC ori, KanR | M.R.K. Alley, unpublished |
pSP250 | pNPTS138 derivative used to restore the wild-type fliF allele in the MT strain by double homologous recombination | This study |
Primers
Designation | Sequence (5′ to 3′) | Source |
oSP895 | GCAATTGAAGCCGGCTGGCGCCAGAACTGCATGTTCACCACTTCGATC | This study |
oSP896 | CATCCAGGGGGTGGAGGGCGCCCGCG | This study |
oSP897 | GCGCCCTCCACCCCCTGGATGGTGCGCACG | This study |
oSP898 | CCGGAGACGCGTCACGGCCGAAGCCGCGAAGTCCAGAAGGGCG | This study |
Culture collections and research laboratories typically subject bacterial strains to periodic cycles of revival and re-preservation to ensure long-term viability. However, serial passaging can introduce spontaneous mutations that are propagated through subsequent generations (Marks et al., 2010; Kram et al., 2017; Knöppel et al., 2018; Ratib et al., 2021). When such mutations confer a selective fitness advantage under laboratory conditions, genomic variants can rapidly dominate the population, leading to significant evolutionary divergence from the progenitor strain. This genetic drift may compromise experimental reproducibility and invalidate comparisons against established reference genomes.
As a case in point, while studying cell morphogenesis in the spiral-shaped bacterium Rhodospirillum rubrum S1 (Pöhl et al., 2024) – the type strain of the species Rhodospirillum (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) – we observed that a culture of this strain originally acquired from the Leibniz Institute DMSZ (Germany) in 2016 under catalogue number DSM 467 lacked its previously reported flagella-mediated swimming motility (Lee & Fitzsimons, 1976). The cells were obtained in a lyophilized state, revived in liquid medium, and immediately preserved in our laboratory collection as a cryostock (hereafter referred to as the MT strain) to minimize genetic divergence from the repository reference, rendering the MT strain effectively identical to DSM 467. Importantly, a culture newly obtained from the DSMZ in 2026 displayed the same non-motile phenotype, confirming that this defect did not arise spontaneously during laboratory handling or cryopreservation. By contrast, normal swimming behavior was observed for a widely studied R. rubrum S1 laboratory lineage provided by the research group of Dirk Schüler (Bayreuth, Germany) that was likely sourced from the American Type Culture Collection in the mid-1960s (hereafter referred to as the DS strain). In line with these observations, transmission electron microscopy revealed that the MT strain failed to assemble flagellar filaments, whereas the DS strain showed the characteristic monopolar or bipolar flagellation pattern documented in the literature (Figure 1a; Lee & Fitzsimons, 1976). To identify the genetic basis of this phenotypic difference, we sequenced the genomes of both laboratory strains and compared them to the R. rubrum S1 reference genome (Munk et al., 2011), which is derived from an R. rubrum S1 stock deposited at the American Type Culture Collection (ATCC 11170).
Comparative sequence analysis revealed that both strains deviated from the reference genome at multiple loci (Figure 1b,c). A subset of these variations was strain-specific, whereas 18 mutations were shared, suggesting that genetic drift had already commenced within the culture collection prior to further divergence of the strains during independent maintenance in the respective laboratories. The shared deviations comprise 10 single nucleotide polymorphisms (SNPs). Five are located in intergenic regions, while the remaining five introduce non-synonymous mutations in predicted open reading frames (ORFs), resulting in amino acid substitutions in the putative gene products (see Extended Data). Both strains additionally harbor insertions and deletions that disrupt ORF Rru_A0205 (DnaJ-like protein), fuse Rru_A0341 (CRISPR-associated protein) with Rru_A0342 (uncharacterized), extend the reading frame of Rru_A2352 (uncharacterized) and fuse Rru_A2834 (uncharacterized) with Rru_A2835 (MotB-like protein).
Beyond the shared deviations, the genome of the MT strain exhibited seven unique differences relative to the reference sequence (Figure 1b,c). Six of these are SNPs located either in intergenic regions or within ORFs, where they result in amino acid substitutions. The remaining deviation was a single base-pair insertion within the gene for the flagellar MS-ring protein FliF (Homma et al., 1987; Ueno et al., 1992), which leads to a shift in the reading frame, thereby disrupting FliF function. The MS-ring forms the foundation of the bacterial flagellum, anchoring the motor in the inner membrane and serving as the base for the assembly of structural components such as the flagellar rod and filament (Francis et al., 1992; Kubori et al., 1992; Ueno et al., 1994). The disruption of fliF in the MT strain thus disrupts flagellar biogenesis, in agreement with the lack of flagella observed by electron microscopy (Figure 1a). Notably, flagellar assembly and motility were fully restored by reverting the frame shift mutation in fliF back to the reference genome sequence (Figure 1a), confirming the absence of other mutations deleterious to flagellar motility.
As expected, the DS strain did not show any mutations in motility-related genes, but it stood out due to its high frequency of unique deviations from the reference genome (Figure 1b,c). In total, the strain harbors 79 unique SNPs, with 11 located in intergenic regions and 68 within open reading frames (ORFs). While the majority of the latter result in silent or non-synonymous mutations, three have more severe functional consequences: two introduce nonsense mutations that truncate Rru_A1282 (a VirG-like protein) and Rru_A1603 (a PhoH-like protein), while the third disrupts the start codon of Rru_A2703 (a TrmH-like protein), thereby precluding the formation of the gene product. In addition to SNPs, the DS strain harbors 3 unique deletions, which shorten ORFs Rru_A0918 (histidine kinase) and Rru_A3395 (LuxR-like transcriptional regulator) and introduce a frameshift in Rru_A1277 (histidine kinase), completely disrupting its function. Furthermore, the strain exhibits 4 unique insertions. One is located in an intergenic region, while two others induce frameshifts that disrupt Rru_A1034 (a histidine kinase) and Rru_A1843 (an OmpA/MotB-like protein). Finally, the DS strain is characterized by a 1,416 bp insertion within Rru_A2108 (a histidine kinase). This segment exhibits high similarity (93% coverage; 73.56% identity; E-value 2E-125) to a genomic region in Pararhodospirillum photometricum DSM 122 (positions 1,859,748–1,861,060), suggesting that it was acquired via horizontal gene transfer.
Collectively, these findings illustrate the rapid pace of bacterial genome evolution under laboratory conditions. Common cultivation practices subject bacteria to various selective pressures, such as the demand for rapid planktonic growth in rich media under fixed environmental conditions, the need to withstand extended incubation in stationary phase on nutrient agar plates, and the requirement to survive prolonged cooling and repeated freeze-thaw cycles during strain maintenance. Adaptive mutations can rapidly accumulate during these stress phases and become fixed in subsequent generations. Consistent with this notion, both laboratory strains accumulated mutations in transcriptional regulators and histidine kinases, which are critical for environmental stress sensing and adaptation. To mitigate the selection of genomic variants, new strains should be cryopreserved at the earliest opportunity after their isolation, keeping the number of serial passages to a minimum. Moreover, practices such as the long-term storage of cultures in stationary phase at room temperature, which are still commonly encountered for photosynthetic bacteria, should be strictly avoided.
Our data demonstrate that, despite sharing the same origin, R. rubrum S1 laboratory and repository strains commonly used in research and biotechnology have diverged significantly over the past decades. The variations in their genomic sequences represent a critical factor that should be carefully considered when comparing experimental results obtained with strains from different lineages.
","references":[{"reference":"Cserti Ek, Rosskopf S, Chang YW, Eisheuer S, Selter L, Shi J, et al., Thanbichler. 2017. Dynamics of the peptidoglycan biosynthetic machinery in the stalked budding bacterium Hyphomonas neptunium. Molecular Microbiology 103: 875-895.
","pubmedId":"","doi":"10.1111/mmi.13593"},{"reference":"Francis NR, Irikura VM, Yamaguchi S, DeRosier DJ, Macnab RM. 1992. Localization of the Salmonella typhimurium flagellar switch protein FliG to the cytoplasmic M-ring face of the basal body. Proceedings of the National Academy of Sciences USA 89: 6304-6308.
","pubmedId":"","doi":"10.1073/PNAS.89.14.6304"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Homma M, Aizawa S, Dean GE, Macnab RM. 1987. Identification of the M-ring protein of the flagellar motor of Salmonella typhimurium. Proceedings of the National Academy of Sciences USA 84: 7483-7487.
","pubmedId":"","doi":"10.1073/PNAS.84.21.7483"},{"reference":"Jung A, Eisheuer S, Cserti Ek, Leicht O, Strobel W, Möll A, et al., Thanbichler. 2015. Molecular toolbox for genetic manipulation of the stalked budding bacterium Hyphomonas neptunium. Applied and Environmental Microbiology 81: 736-744.
","pubmedId":"","doi":"10.1128/AEM.03104-14"},{"reference":"Knöppel A, Knopp M, Albrecht LM, Lundin E, Lustig U, Näsvall J, Andersson DI. 2018. Genetic adaptation to growth under laboratory conditions in Escherichia coli and Salmonella enterica. Frontiers in Microbiology 9: 10.3389/fmicb.2018.00756.
","pubmedId":"","doi":"10.3389/FMICB.2018.00756"},{"reference":"Kram KE, Geiger C, Ismail WM, Lee H, Tang H, Foster PL, Finkel SE. 2017. Adaptation of Escherichia coli to long-term serial passage in complex medium: evidence of parallel evolution. mSystems 2: 10.1128/msystems.00192-16.
","pubmedId":"","doi":"10.1128/MSYSTEMS.00192-16"},{"reference":"Kubori T, Shimamoto N, Yamaguchi S, Namba K, Aizawa SI. 1992. Morphological pathway of flagellar assembly in Salmonella typhimurium. Journal of Molecular Biology 226: 433-446.
","pubmedId":"","doi":"10.1016/0022-2836(92)90958-M"},{"reference":"Lee AG, Fitzsimons JTR. 1976. Motility in normal and filamentous forms of Rhodospirillum rubrum. Journal of General Microbiology 93: 346-354.
","pubmedId":"","doi":"10.1099/00221287-93-2-346"},{"reference":"Marks ME, Castro-Rojas CM, Teiling C, Du L, Kapatral V, Walunas TL, Crosson S. 2010. The genetic basis of laboratory adaptation in Caulobacter crescentus. Journal of Bacteriology 192: 3678-3688.
","pubmedId":"","doi":"10.1128/JB.00255-10"},{"reference":"Molisch H (1907) Die Purpurbakterien nach neuen Untersuchungen I-VII. Gustav Fischer, Jena.
","pubmedId":"","doi":""},{"reference":"Munk AC, Copeland A, Lucas S, Lapidus A, Del Rio TG, Barry K, et al., Schwartz. 2011. Complete genome sequence of Rhodospirillum rubrum type strain (S1T). Standards in Genomic Sciences 4: 293-302.
","pubmedId":"","doi":"10.4056/sigs.1804360"},{"reference":"van Niel CB. 1944. The culture, general physiology, morphology, and classification of the non-sulfur purple and brown bacteria. Bacteriological Reviews 8: 1-118.
","pubmedId":"","doi":"10.1128/br.8.1.1-118.1944"},{"reference":"Pfennig N, Trüper HG. 1971. Type and neotype strains of the species of phototrophic bacteria maintained in pure culture. International Journal of Systematic Bacteriology 21: 19-24.
","pubmedId":"","doi":"10.1099/00207713-21-1-19"},{"reference":"Pöhl S, Giacomelli G, Meyer FM, Kleeberg V, Cohen EJ, Biboy J, et al., Thanbichler. 2024. An outer membrane porin-lipoprotein complex modulates elongasome movement to establish cell curvature in Rhodospirillum rubrum. Nature Communications 15: 10.1038/s41467-024-51790-z.
","pubmedId":"","doi":"10.1038/s41467-024-51790-z"},{"reference":"Ratib NR, Seidl F, Ehrenreich IM, Finkel SE. 2021. Evolution in long-term stationary-phase batch culture: emergence of divergent Escherichia coli lineages over 1,200 days. mBio 12: 10.1128/mbio.03337-20.
","pubmedId":"","doi":"10.1128/MBIO.03337-20"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1992. M ring, S ring and proximal rod of the flagellar basal body of Salmonella typhimurium are composed of subunits of a single protein, FliF. Journal of Molecular Biology 227: 672-677.
","pubmedId":"","doi":"10.1016/0022-2836(92)90216-7"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1994. Domain structures of the MS ring component protein (FliF) of the flagellar basal body of Salmonella typhimurium. Journal of Molecular Biology 236: 546-555.
","pubmedId":"","doi":"10.1006/JMBI.1994.1164"},{"reference":"Zheng Z, Li S, Su J, Leung AWS, Lam TW, Luo R. 2022. Symphonizing pileup and full-alignment for deep learning-based long-read variant calling. Nature Computational Science 2: 797-803.
","pubmedId":"","doi":"10.1038/s43588-022-00387-x"}],"title":"Comparative genomics of Rhodospirillum rubrum S1 lineages reveals significant differences from the reference genome
","reviews":[{"reviewer":{"displayName":"Schüler Dirk"},"openAcknowledgement":true,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"8d06b17f-21d1-4de5-a9f7-e5ef3ed3d03b","decision":"accept","abstract":"Laboratory cultivation imposes selective pressures that drive rapid bacterial evolution, compromising experimental reproducibility. Here, comparative phenotypic and genomic analyses revealed significant divergence between two Rhodospirillum rubrum S1 lineages originally obtained from the same culture collection. Although both shared baseline variations relative to the reference genome, their trajectories diverged. A recently sourced line (DSM 467) exhibited few additional mutations, including a fliF frameshift abolishing motility. Conversely, a long-maintained laboratory line remained motile but harbored numerous unique variants, particularly within stress-responsive histidine kinases. These results demonstrate passaging-induced genomic drift, highlighting the necessity of cryopreservation and minimal serial cultivation to ensure strain fidelity.
","acknowledgements":"We thank Dirk Schüler for providing his R. rubrum S1 laboratory strain, and Doreen Meier and Marta Pulido Sánchez for their assistance with the deposition of the genomic sequencing data. We are also grateful to Frank-Dietrich Müller, Hartmut Grammel and Reinhard Bachofen for their help in reconstructing the historical lineage of the DS strain.
","authors":[{"affiliations":["Marburg University, Marburg, Germany"],"departments":["Department of Biology"],"credit":["conceptualization","dataCuration","formalAnalysis","investigation","methodology","visualization","writing_originalDraft"],"email":"sebastian.poehl@biologie.uni-marburg.de","firstName":"Sebastian","lastName":"Pöhl","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-6612-4340"},{"affiliations":["Max Planck Institute for Terrestrial Microbiology, Marburg, Germany"],"departments":[""],"credit":["methodology"],"email":"anke.treunerLange@mpi-marburg.mpg.de","firstName":"Anke","lastName":"Treuner-Lange","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6435-5642"},{"affiliations":["Marburg University, Marburg, Germany","Marburg, Germany"],"departments":["Department of Biology","Microbes-for-Climate (M4C) Cluster of Excellence & SYNMIKRO"],"credit":["conceptualization","fundingAcquisition","investigation","project","supervision","writing_originalDraft"],"email":"thanbichler@uni-marburg.de","firstName":"Martin","lastName":"Thanbichler","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1303-1442"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"This spreadsheet details both the shared and unique variants identified across both strains, alongside quality control metrics for the underlying sequencing data. Additionally, it specifies the affected open reading frames (ORFs) and the predicted functional annotations of the encoded proteins (XLSX file; Microsoft Excel).
","doi":"10.22002/mhmjd-4pr39","resourceType":"Dataset","name":"Extended Data.xlsx","url":"https://portal.micropublication.org/uploads/cd49c89766674b157f4bdd201e048838.xlsx"}],"funding":"This work was supported by Marburg University (core funding to M.T.) and the Max Planck Society (core funding to A.T.-L.).
","image":{"url":"https://portal.micropublication.org/uploads/6b01f8925393083e1879d7dc278d6a31.png"},"imageCaption":"(a) Transmission electron micrographs showing representative cells of the R. rubrum S1 MT and DS strains, alongside a derivative of the MT strain (SP343), in which the frameshift mutation in fliF was corrected to restore the wild-type fliF allele matching the R. rubrum S1 reference genome sequence. Bar: 1 µm. Arrowheads indicate attached and sheared flagella. (b) Schematic mapping of unique and shared genomic deviations in the MT and DS laboratory strains relative to the R. rubrum S1 reference genome (ATCC 11170). The position of the frameshift mutation in fliF is indicated. Due to the close proximity of certain mutations, individual bars may indicate multiple closely spaced genomic variants. (c) Summary of unique and shared genomic variants in the two laboratory strains. Mixed variants are defined as loci where more than 25% of the reads support the reference genome sequence. Details are provided in the Extended Data file.
","imageTitle":"Comparison of R. rubrum S1 laboratory strains
","methods":"Growth conditions. For the preparation of genomic DNA, the variants of R. rubrum S1 (DSM 467) (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) investigated in this study were grown to exponential phase in the dark at 28 °C in liquid Tryptic Soy (TS) medium (1.7 % tryptone, 0.3% soytone, 0.25% dextrose, 0.5% NaCl, 0.25% K2HPO4) shaking at 210 rpm. To visualize flagella, cells were grown in a MIR-154 daylight-incubator (Panasonic, Japan) at 28 °C in liquid YPS medium (0.3% yeast extract, 0.3% peptone, 1 mM CaCl2, 1 mM MgSO4) rotating at 20 rpm in Falcon tubes under microoxic conditions (14 ml culture in closed 15 ml Falcon tubes).
Plasmid and strain construction. The bacterial strains, plasmids and oligonucleotides used in this study are listed in the Reagents section. To construct plasmid pSP250, used to reverse the frameshift mutation in the fliF gene, the regions flanking base pair 642,095 of the R. rubrum S1 MT laboratory strain chromosome were PCR-amplified using primer pairs oSP895/oSP896 and oSP897/oSP898. The amplification product, which carried a single-base-pair deletion that removed the insertion disrupting the fliF reading frame, was cloned into the sacB-containing allelic replacement vector pNPTS138 (M.R.K. Alley, unpublished) via Gibson assembly, using HindIII- and NheI-digested vector DNA (Gibson et al., 2009) and E. coli TOP10 (Thermo Fisher Scientific, USA) as the cloning host. The resulting plasmid was verified by DNA sequencing. To construct the fliF revertant SP343, the MT strain was transformed with plasmid pSP250 via conjugation, employing the donor strain E. coli WM3064 (Pöhl et al., 2024). Single integrants were subjected to allelic replacement based on sucrose counterselection to select for a second recombination event (Cserti et al., 2017; Jung et al., 2015). Clones that had undergone double homologous recombination, thereby restoring the wild-type fliF allele, were identified by colony PCR, followed by sequencing of the PCR products.
Transmission electron microscopy. Cells were grown under microoxic conditions at 28 °C in liquid YPS medium to an OD600 of 0.4, harvested by centrifugation for 3 min at 2500 xg, and then resuspended in the same, the 0.05-fold or the 0.0125-fold volume in fresh YPS medium, using plastic tips with cut-off tips to avoid the shearing of flagella. For imaging, 50 μl aliquots of the samples were transferred to parafilm. Subsequently, glow-discharged carbon-coated copper 300 mesh grids were placed upside-down on top of the sample (S162-3; Plano Wetzlar, Germany). After 10 min of incubation, the grids were washed twice with water and treated for 10 sec with 2% (w/v) uranyl acetate. Micrographs were taken with a JEM-1400 transmission electron microscope (JEOL, Japan) at an acceleration voltage of 100 kV. Fiji 1.54f (Schindelin et al., 2012) was used for data analysis.
Genome sequencing and comparison. Genomic DNA was purified with the NucleoSpin® Microbial DNA kit (Macherey-Nagel, Germany; Ref: 740235) according to the manufacturer’s instructions. Bacterial genome sequencing was performed by Plasmidsaurus (Louisville, KY, USA) integrating long-read Oxford Nanopore and short-read Illumina sequencing technologies, followed by custom analysis and annotation (Supplementary Data). Clair3 (Zheng et al., 2022) was used to compare the genomes obtained to the R. rubrum S1 reference sequence (GenBank accession no. NC_007643.1; Munk et al., 2011) and identify SNPs and small indels.
Availability of biological material. The bacterial strains used in this study are available from the corresponding author upon request.
Data availability. The genome sequences of the two R. rubrum S1 laboratory strains analyzed in this study have been deposited to the European Nucleotide Archive (ENA) with the dataset identifier PRJEB114701 [https://www.ebi.ac.uk/ena/browser/view/PRJEB114701]. All other data generated in this study are included in the manuscript or the Extended Data file.
","reagents":"Strains
Strain | History/genotype | Source |
Rhodospirillum rubrum S1 (DSM 467) | This strain is the neotype strain of R. rubrum provided by the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSMZ, Germany) under catalogue number DSM 467. DSMZ originally obtained the culture from the American Type Culture Collection (ex ATCC 11170). A comparison of its DSM catalogue number to nearby entries suggests an acquisition date between 1973 and 1974. | DSMZ |
Rhodospirillum rubrum S1 (MT strain)
| The strain was obtained from the DSMZ in 2017 as a lyophilized sample under catalogue number DSM 467. The cells were resuspended and revived in tryptic soy (TS) medium prior to direct storage as a master cryostock. | DSMZ |
Rhodospirillum rubrum S1 (DS strain) | The DS strain was obtained in the early 2010s from Hartmut Grammel (Hochschule Biberach, Germany), who had received it from Robin Ghosh (University of Stuttgart, Germany) around the same time. Ghosh, who has published research on this strain since 1993, originally acquired it from Reinhard Bachofen (University of Zurich, Switzerland). Bachofen initiated his work on this specific lineage in 1964. Since the original culture was sourced prior to the establishment of the DSMZ, it probably tracks back to the original ATCC 11170 repository stock (personal communication with H. Grammel and R. Bachofen). | Dirk Schüler (University of Bayreuth, Germany) |
Rhodosprillum rubrum SP343 | Derivative of the R. rubrum S1 MT laboratory strain carrying the wild-type fliF allele | This study |
Escherichia coli TOP10 | F– mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG | Thermo Fisher Scientific |
Escherichia coli WM3064 | thrB1004 pro thi rpsL hsdS lacZΔM15 RP4–1360 Δ(araBAD)567 ΔdapA1341::[erm pir(wt)] | W. Metcalf, unpublished |
Plasmids
Designation | Description | Source |
pNPTS138 | sacB‐containing suicide vector used for double homologous recombination, pUC ori, KanR | M.R.K. Alley, unpublished |
pSP250 | pNPTS138 derivative used to restore the wild-type fliF allele in the MT strain by double homologous recombination | This study |
Primers
Designation | Sequence (5′ to 3′) | Source |
oSP895 | GCAATTGAAGCCGGCTGGCGCCAGAACTGCATGTTCACCACTTCGATC | This study |
oSP896 | CATCCAGGGGGTGGAGGGCGCCCGCG | This study |
oSP897 | GCGCCCTCCACCCCCTGGATGGTGCGCACG | This study |
oSP898 | CCGGAGACGCGTCACGGCCGAAGCCGCGAAGTCCAGAAGGGCG | This study |
Culture collections and research laboratories typically subject bacterial strains to periodic cycles of revival and re-preservation to ensure long-term viability. However, serial passaging can introduce spontaneous mutations that are propagated through subsequent generations (Marks et al., 2010; Kram et al., 2017; Knöppel et al., 2018; Ratib et al., 2021). When such mutations confer a selective fitness advantage under laboratory conditions, genomic variants can rapidly dominate the population, leading to significant evolutionary divergence from the progenitor strain. This genetic drift may compromise experimental reproducibility and invalidate comparisons against established reference genomes.
As a case in point, while studying cell morphogenesis in the spiral-shaped bacterium Rhodospirillum rubrum S1 (Pöhl et al., 2024) – the type strain of the species Rhodospirillum (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) – we observed that a culture of this strain originally acquired from the Leibniz Institute DSMZ (Germany) in 2016 under catalogue number DSM 467 lacked its previously reported flagella-mediated swimming motility (Lee & Fitzsimons, 1976). The cells were obtained in a lyophilized state, revived in liquid medium, and immediately preserved in our laboratory collection as a cryostock (hereafter designated as the MT strain) to minimize genetic divergence from the repository reference, rendering this lineage effectively identical to DSM 467. Importantly, a culture newly procured from the DSMZ in 2026 displayed the same non-motile phenotype, confirming that this defect did not arise spontaneously during laboratory handling or cryopreservation. By contrast, normal swimming behavior was observed for a widely studied R. rubrum S1 laboratory lineage provided by the research group of Dirk Schüler (Bayreuth, Germany) that was likely sourced from the American Type Culture Collection in the mid-1960s (hereafter designated as the DS strain). In line with these observations, transmission electron microscopy revealed that the MT strain failed to assemble flagellar filaments, whereas the DS strain showed the characteristic monopolar or bipolar flagellation pattern documented in the literature (Figure 1a; Lee & Fitzsimons, 1976). To identify the genetic basis of this phenotypic difference, we sequenced the genomes of both laboratory strains and compared them to the R. rubrum S1 reference genome (Munk et al., 2011), which is derived from an R. rubrum S1 stock deposited at the American Type Culture Collection (ATCC 11170).
Comparative sequence analysis revealed that both strains deviated from the reference genome at multiple loci (Figure 1b,c). A subset of these variations was strain-specific, whereas 18 mutations were shared, suggesting that genetic drift had already commenced within the culture collection prior to further divergence of the strains during independent maintenance in the respective laboratories. The shared deviations comprise 10 single nucleotide polymorphisms (SNPs). Five are located in intergenic regions, while the remaining five introduce non-synonymous mutations in predicted open reading frames (ORFs), resulting in amino acid substitutions in the putative gene products (see Extended Data). Both strains additionally harbor insertions and deletions that disrupt ORF Rru_A0205 (DnaJ-like protein), fuse Rru_A0341 (CRISPR-associated protein) with Rru_A0342 (uncharacterized), extend the reading frame of Rru_A2352 (uncharacterized) and fuse Rru_A2834 (uncharacterized) with Rru_A2835 (MotB-like protein).
Beyond the shared deviations, the genome of the MT strain exhibited seven unique differences relative to the reference sequence (Figure 1b,c). Six of these are SNPs located either in intergenic regions or within ORFs, where they result in amino acid substitutions. The remaining deviation was a single base-pair insertion within the gene for the flagellar MS-ring protein FliF (Homma et al., 1987; Ueno et al., 1992), which leads to a shift in the reading frame, thereby disrupting FliF function. The MS-ring forms the foundation of the bacterial flagellum, anchoring the motor in the inner membrane and serving as the base for the assembly of structural components such as the flagellar rod and filament (Francis et al., 1992; Kubori et al., 1992; Ueno et al., 1994). The disruption of fliF in the MT strain thus abolishes flagellar biogenesis, in agreement with the lack of flagella observed by electron microscopy (Figure 1a). Notably, flagellar assembly and motility were fully restored by reverting the frameshift mutation in fliF back to the reference genome sequence (Figure 1a), confirming the absence of other mutations deleterious to flagellar motility.
As expected, the DS strain did not show any mutations in motility-related genes, but it stood out due to its high frequency of unique deviations from the reference genome (Figure 1b,c). In total, the strain harbors 79 unique SNPs, with 11 located in intergenic regions and 68 within open reading frames (ORFs). While the majority of the latter result in silent or non-synonymous mutations, three have more severe functional consequences: two introduce nonsense mutations that truncate Rru_A1282 (a VirG-like protein) and Rru_A1603 (a PhoH-like protein), while the third disrupts the start codon of Rru_A2703 (a TrmH-like protein), thereby precluding the formation of the gene product. In addition to SNPs, the DS strain harbors 3 unique deletions, which shorten ORFs Rru_A0918 (histidine kinase) and Rru_A3395 (LuxR-like transcriptional regulator) and introduce a frameshift in Rru_A1277 (histidine kinase), completely disrupting its function. Furthermore, the strain exhibits 4 unique insertions. One is located in an intergenic region, while two others induce frameshifts that disrupt Rru_A1034 (a histidine kinase) and Rru_A1843 (an OmpA/MotB-like protein). Finally, the DS strain is characterized by a 1,416 bp insertion within Rru_A2108 (a histidine kinase). This segment exhibits high similarity (93% coverage; 73.56% identity; E-value 2E-125) to a genomic region in Pararhodospirillum photometricum DSM 122 (positions 1,859,748–1,861,060), suggesting that it was acquired via horizontal gene transfer.
Collectively, these findings illustrate the rapid pace of bacterial genome evolution under laboratory conditions. Common cultivation practices subject bacteria to various selective pressures, such as the demand for rapid planktonic growth in rich media under fixed environmental conditions, the need to withstand extended incubation in stationary phase on nutrient agar plates, and the requirement to survive prolonged cooling and repeated freeze-thaw cycles during strain maintenance. Adaptive mutations can rapidly accumulate during these stress phases and become fixed in subsequent generations. Consistent with this notion, both laboratory strains accumulated mutations in transcriptional regulators and histidine kinases, which are critical for environmental stress sensing and adaptation. To mitigate the selection of genomic variants, new strains should be cryopreserved at the earliest opportunity after their isolation, keeping the number of serial passages to a minimum. Moreover, practices such as the long-term storage of cultures in stationary phase at room temperature, which are still commonly encountered for photosynthetic bacteria, should be strictly avoided.
Our data demonstrate that, despite sharing the same origin, R. rubrum S1 laboratory and repository strains commonly used in research and biotechnology have diverged significantly over the past decades. The variations in their genomic sequences represent a critical factor that should be carefully considered when comparing experimental results obtained with strains from different lineages.
","references":[{"reference":"Cserti E, Rosskopf S, Chang YW, Eisheuer S, Selter L, Shi J, et al., Thanbichler. 2017. Dynamics of the peptidoglycan biosynthetic machinery in the stalked budding bacterium Hyphomonas neptunium. Molecular Microbiology 103: 875-895.
","pubmedId":"","doi":"10.1111/mmi.13593"},{"reference":"Francis NR, Irikura VM, Yamaguchi S, DeRosier DJ, Macnab RM. 1992. Localization of the Salmonella typhimurium flagellar switch protein FliG to the cytoplasmic M-ring face of the basal body. Proceedings of the National Academy of Sciences USA 89: 6304-6308.
","pubmedId":"","doi":"10.1073/PNAS.89.14.6304"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Homma M, Aizawa S, Dean GE, Macnab RM. 1987. Identification of the M-ring protein of the flagellar motor of Salmonella typhimurium. Proceedings of the National Academy of Sciences USA 84: 7483-7487.
","pubmedId":"","doi":"10.1073/PNAS.84.21.7483"},{"reference":"Jung A, Eisheuer S, Cserti E, Leicht O, Strobel W, Möll A, et al., Thanbichler. 2015. Molecular toolbox for genetic manipulation of the stalked budding bacterium Hyphomonas neptunium. Applied and Environmental Microbiology 81: 736-744.
","pubmedId":"","doi":"10.1128/AEM.03104-14"},{"reference":"Knöppel A, Knopp M, Albrecht LM, Lundin E, Lustig U, Näsvall J, Andersson DI. 2018. Genetic adaptation to growth under laboratory conditions in Escherichia coli and Salmonella enterica. Frontiers in Microbiology 9: 10.3389/fmicb.2018.00756.
","pubmedId":"","doi":"10.3389/FMICB.2018.00756"},{"reference":"Kram KE, Geiger C, Ismail WM, Lee H, Tang H, Foster PL, Finkel SE. 2017. Adaptation of Escherichia coli to long-term serial passage in complex medium: evidence of parallel evolution. mSystems 2: 10.1128/msystems.00192-16.
","pubmedId":"","doi":"10.1128/MSYSTEMS.00192-16"},{"reference":"Kubori T, Shimamoto N, Yamaguchi S, Namba K, Aizawa SI. 1992. Morphological pathway of flagellar assembly in Salmonella typhimurium. Journal of Molecular Biology 226: 433-446.
","pubmedId":"","doi":"10.1016/0022-2836(92)90958-M"},{"reference":"Lee AG, Fitzsimons JTR. 1976. Motility in normal and filamentous forms of Rhodospirillum rubrum. Journal of General Microbiology 93: 346-354.
","pubmedId":"","doi":"10.1099/00221287-93-2-346"},{"reference":"Marks ME, Castro-Rojas CM, Teiling C, Du L, Kapatral V, Walunas TL, Crosson S. 2010. The genetic basis of laboratory adaptation in Caulobacter crescentus. Journal of Bacteriology 192: 3678-3688.
","pubmedId":"","doi":"10.1128/JB.00255-10"},{"reference":"Molisch H (1907) Die Purpurbakterien nach neuen Untersuchungen I-VII. Gustav Fischer, Jena.
","pubmedId":"","doi":""},{"reference":"Munk AC, Copeland A, Lucas S, Lapidus A, Del Rio TG, Barry K, et al., Schwartz. 2011. Complete genome sequence of Rhodospirillum rubrum type strain (S1T). Standards in Genomic Sciences 4: 293-302.
","pubmedId":"","doi":"10.4056/sigs.1804360"},{"reference":"van Niel CB. 1944. The culture, general physiology, morphology, and classification of the non-sulfur purple and brown bacteria. Bacteriological Reviews 8: 1-118.
","pubmedId":"","doi":"10.1128/br.8.1.1-118.1944"},{"reference":"Pfennig N, Trüper HG. 1971. Type and neotype strains of the species of phototrophic bacteria maintained in pure culture. International Journal of Systematic Bacteriology 21: 19-24.
","pubmedId":"","doi":"10.1099/00207713-21-1-19"},{"reference":"Pöhl S, Giacomelli G, Meyer FM, Kleeberg V, Cohen EJ, Biboy J, et al., Thanbichler. 2024. An outer membrane porin-lipoprotein complex modulates elongasome movement to establish cell curvature in Rhodospirillum rubrum. Nature Communications 15: 7616.
","pubmedId":"","doi":"10.1038/s41467-024-51790-z"},{"reference":"Ratib NR, Seidl F, Ehrenreich IM, Finkel SE. 2021. Evolution in long-term stationary-phase batch culture: emergence of divergent Escherichia coli lineages over 1,200 days. mBio 12: 10.1128/mbio.03337-20.
","pubmedId":"","doi":"10.1128/MBIO.03337-20"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1992. M ring, S ring and proximal rod of the flagellar basal body of Salmonella typhimurium are composed of subunits of a single protein, FliF. Journal of Molecular Biology 227: 672-677.
","pubmedId":"","doi":"10.1016/0022-2836(92)90216-7"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1994. Domain structures of the MS ring component protein (FliF) of the flagellar basal body of Salmonella typhimurium. Journal of Molecular Biology 236: 546-555.
","pubmedId":"","doi":"10.1006/JMBI.1994.1164"},{"reference":"Zheng Z, Li S, Su J, Leung AWS, Lam TW, Luo R. 2022. Symphonizing pileup and full-alignment for deep learning-based long-read variant calling. Nature Computational Science 2: 797-803.
","pubmedId":"","doi":"10.1038/s43588-022-00387-x"}],"title":"Comparative genomics of Rhodospirillum rubrum S1 lineages reveals significant differences from the reference genome
","reviews":[],"curatorReviews":[]},{"id":"9332acf8-e190-416d-8eb1-809b65c2542c","decision":"publish","abstract":"Laboratory cultivation imposes selective pressures that drive rapid bacterial evolution, compromising experimental reproducibility. Here, comparative phenotypic and genomic analyses revealed significant divergence between two Rhodospirillum rubrum S1 lineages originally obtained from the same culture collection. Although both shared baseline variations relative to the reference genome, their trajectories diverged. A recently sourced line (DSM 467) exhibited few additional mutations, including a fliF frameshift abolishing motility. Conversely, a long-maintained laboratory line remained motile but harbored numerous unique variants, particularly within stress-responsive histidine kinases. These results demonstrate passaging-induced genomic drift, highlighting the necessity of cryopreservation and minimal serial cultivation to ensure strain fidelity.
","acknowledgements":"We thank Dirk Schüler for providing his R. rubrum S1 laboratory strain, and Doreen Meier and Marta Pulido Sánchez for their assistance with the deposition of the genomic sequencing data. We are also grateful to Frank-Dietrich Müller, Hartmut Grammel and Reinhard Bachofen for their help in reconstructing the historical lineage of the DS strain.
","authors":[{"affiliations":["Marburg University, Marburg, Germany"],"departments":["Department of Biology"],"credit":["conceptualization","dataCuration","formalAnalysis","investigation","methodology","visualization","writing_originalDraft"],"email":"sebastian.poehl@biologie.uni-marburg.de","firstName":"Sebastian","lastName":"Pöhl","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-6612-4340"},{"affiliations":["Max Planck Institute for Terrestrial Microbiology, Marburg, Germany"],"departments":[""],"credit":["methodology"],"email":"anke.treunerLange@mpi-marburg.mpg.de","firstName":"Anke","lastName":"Treuner-Lange","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6435-5642"},{"affiliations":["Marburg University, Marburg, Germany","Marburg, Germany"],"departments":["Department of Biology","Microbes-for-Climate (M4C) Cluster of Excellence & SYNMIKRO"],"credit":["conceptualization","fundingAcquisition","investigation","project","supervision","writing_originalDraft"],"email":"thanbichler@uni-marburg.de","firstName":"Martin","lastName":"Thanbichler","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1303-1442"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"This spreadsheet details both the shared and unique variants identified across both strains, alongside quality control metrics for the underlying sequencing data. Additionally, it specifies the affected open reading frames (ORFs) and the predicted functional annotations of the encoded proteins (XLSX file; Microsoft Excel).
","doi":"10.22002/mhmjd-4pr39","resourceType":"Dataset","name":"Extended Data.xlsx","url":"https://portal.micropublication.org/uploads/cd49c89766674b157f4bdd201e048838.xlsx"}],"funding":"This work was supported by Marburg University (core funding to M.T.) and the Max Planck Society (core funding to A.T.-L.).
","image":{"url":"https://portal.micropublication.org/uploads/6b01f8925393083e1879d7dc278d6a31.png"},"imageCaption":"(a) Transmission electron micrographs showing representative cells of the R. rubrum S1 MT and DS strains, alongside a derivative of the MT strain (SP343), in which the frameshift mutation in fliF was corrected to restore the wild-type fliF allele matching the R. rubrum S1 reference genome sequence. Bar: 1 µm. Arrowheads indicate attached and sheared flagella. (b) Schematic mapping of unique and shared genomic deviations in the MT and DS laboratory strains relative to the R. rubrum S1 reference genome (ATCC 11170). The position of the frameshift mutation in fliF is indicated. Due to the close proximity of certain mutations, individual bars may indicate multiple closely spaced genomic variants. (c) Summary of unique and shared genomic variants in the two laboratory strains. Mixed variants are defined as loci where more than 25% of the reads support the reference genome sequence. Details are provided in the Extended Data file.
","imageTitle":"Comparison of R. rubrum S1 laboratory strains
","methods":"Growth conditions. For the preparation of genomic DNA, the variants of R. rubrum S1 (DSM 467) (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) investigated in this study were grown to exponential phase in the dark at 28 °C in liquid Tryptic Soy (TS) medium (1.7% tryptone, 0.3% soytone, 0.25% dextrose, 0.5% NaCl, 0.25% K2HPO4) shaking at 210 rpm. To visualize flagella, cells were grown in a MIR-154 daylight-incubator (Panasonic, Japan) at 28 °C in liquid YPS medium (0.3% yeast extract, 0.3% peptone, 1 mM CaCl2, 1 mM MgSO4) rotating at 20 rpm in Falcon tubes under microoxic conditions (14 ml culture in closed 15 ml Falcon tubes).
Plasmid and strain construction. The bacterial strains, plasmids and oligonucleotides used in this study are listed in the Reagents section. To construct plasmid pSP250, used to reverse the frameshift mutation in the fliF gene, the regions flanking base pair 642,095 of the R. rubrum S1 MT laboratory strain chromosome were PCR-amplified using primer pairs oSP895/oSP896 and oSP897/oSP898. The amplification products, which carried a single-base-pair deletion that removed the insertion disrupting the fliF reading frame, was cloned into the sacB-containing allelic replacement vector pNPTS138 (M.R.K. Alley, unpublished) via Gibson assembly, using HindIII- and NheI-digested vector DNA (Gibson et al., 2009) and E. coli TOP10 (Thermo Fisher Scientific, USA) as the cloning host. The resulting plasmid was verified by DNA sequencing. To construct the fliF revertant SP343, the MT strain was transformed with plasmid pSP250 via conjugation, employing the donor strain E. coli WM3064 (Pöhl et al., 2024). Single integrants were subjected to allelic replacement based on sucrose counterselection to select for a second recombination event (Cserti et al., 2017; Jung et al., 2015). Clones that had undergone double homologous recombination, thereby restoring the wild-type fliF allele, were identified by colony PCR, followed by sequencing of the PCR products.
Transmission electron microscopy. Cells were grown under microoxic conditions at 28 °C in liquid YPS medium to an OD600 of 0.4, harvested by centrifugation for 3 min at 2500 xg, and then resuspended in the same, the 0.05-fold or the 0.0125-fold volume in fresh YPS medium, using plastic tips with cut-off tips to avoid the shearing of flagella. For imaging, 50 μl aliquots of the samples were transferred to parafilm. Subsequently, glow-discharged carbon-coated copper 300 mesh grids were placed upside-down on top of the sample (S162-3; Plano Wetzlar, Germany). After 10 min of incubation, the grids were washed twice with water and treated for 10 sec with 2% (w/v) uranyl acetate. Micrographs were taken with a JEM-1400 transmission electron microscope (JEOL, Japan) at an acceleration voltage of 100 kV. Fiji 1.54f (Schindelin et al., 2012) was used for data analysis.
Genome sequencing and comparison. Genomic DNA was purified with the NucleoSpin® Microbial DNA kit (Macherey-Nagel, Germany; Ref: 740235) according to the manufacturer’s instructions. Bacterial genome sequencing was performed by Plasmidsaurus (Louisville, KY, USA) integrating long-read Oxford Nanopore and short-read Illumina sequencing technologies, followed by custom analysis and annotation (Supplementary Data). Clair3 (Zheng et al., 2022) was used to compare the genomes obtained to the R. rubrum S1 reference sequence (GenBank accession no. NC_007643.1; Munk et al., 2011) and identify SNPs and small indels.
Availability of biological material. The bacterial strains used in this study are available from the corresponding author upon request.
Data availability. The genome sequences of the two R. rubrum S1 laboratory strains analyzed in this study have been deposited to the European Nucleotide Archive (ENA) with the dataset identifier PRJEB114701 [https://www.ebi.ac.uk/ena/browser/view/PRJEB114701]. All other data generated in this study are included in the manuscript or the Extended Data file.
","reagents":"Strains
Strain | History/genotype | Source |
Rhodospirillum rubrum S1 (DSM 467) | This strain is the neotype strain of R. rubrum provided by the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (DSMZ, Germany) under catalogue number DSM 467. DSMZ originally obtained the culture from the American Type Culture Collection (ex ATCC 11170). A comparison of its DSM catalogue number to nearby entries suggests an acquisition date between 1973 and 1974. | DSMZ |
Rhodospirillum rubrum S1 (MT strain)
| The strain was obtained from the DSMZ in 2017 as a lyophilized sample under catalogue number DSM 467. The cells were resuspended and revived in tryptic soy (TS) medium prior to direct storage as a master cryostock. | DSMZ |
Rhodospirillum rubrum S1 (DS strain) | The DS strain was obtained in the early 2010s from Hartmut Grammel (Hochschule Biberach, Germany), who had received it from Robin Ghosh (University of Stuttgart, Germany) around the same time. Ghosh, who has published research on this strain since 1993, originally acquired it from Reinhard Bachofen (University of Zurich, Switzerland). Bachofen initiated his work on this specific lineage in 1964. Since the original culture was sourced prior to the establishment of the DSMZ, it probably tracks back to the original ATCC 11170 repository stock (personal communication with H. Grammel and R. Bachofen). | Dirk Schüler (University of Bayreuth, Germany) |
Rhodosprillum rubrum SP343 | Derivative of the R. rubrum S1 MT laboratory strain carrying the wild-type fliF allele | This study |
Escherichia coli TOP10 | F– mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG | Thermo Fisher Scientific |
Escherichia coli WM3064 | thrB1004 pro thi rpsL hsdS lacZΔM15 RP4–1360 Δ(araBAD)567 ΔdapA1341::[erm pir(wt)] | W. Metcalf, unpublished |
Plasmids
Designation | Description | Source |
pNPTS138 | sacB‐containing suicide vector used for double homologous recombination, pUC ori, KanR | M.R.K. Alley, unpublished |
pSP250 | pNPTS138 derivative used to restore the wild-type fliF allele in the MT strain by double homologous recombination | This study |
Primers
Designation | Sequence (5′ to 3′) | Source |
oSP895 | GCAATTGAAGCCGGCTGGCGCCAGAACTGCATGTTCACCACTTCGATC | This study |
oSP896 | CATCCAGGGGGTGGAGGGCGCCCGCG | This study |
oSP897 | GCGCCCTCCACCCCCTGGATGGTGCGCACG | This study |
oSP898 | CCGGAGACGCGTCACGGCCGAAGCCGCGAAGTCCAGAAGGGCG | This study |
Culture collections and research laboratories typically subject bacterial strains to periodic cycles of revival and re-preservation to ensure long-term viability. However, serial passaging can introduce spontaneous mutations that are propagated through subsequent generations (Marks et al., 2010; Kram et al., 2017; Knöppel et al., 2018; Ratib et al., 2021). When such mutations confer a selective fitness advantage under laboratory conditions, genomic variants can rapidly dominate the population, leading to significant evolutionary divergence from the progenitor strain. This genetic drift may compromise experimental reproducibility and invalidate comparisons against established reference genomes.
As a case in point, while studying cell morphogenesis in the spiral-shaped bacterium Rhodospirillum rubrum S1 (Pöhl et al., 2024) – the type strain of the species Rhodospirillum (Molisch, 1907; van Niel, 1944; Pfennig & Trüper, 1971) – we observed that a culture of this strain originally acquired from the Leibniz Institute DSMZ (Germany) in 2016 under catalogue number DSM 467 lacked its previously reported flagella-mediated swimming motility (Lee & Fitzsimons, 1976). The cells were obtained in a lyophilized state, revived in liquid medium, and immediately preserved in our laboratory collection as a cryostock (hereafter designated as the MT strain) to minimize genetic divergence from the repository reference, rendering this lineage effectively identical to DSM 467. Importantly, a culture newly procured from the DSMZ in 2026 displayed the same non-motile phenotype, confirming that this defect did not arise spontaneously during laboratory handling or cryopreservation. By contrast, normal swimming behavior was observed for a widely studied R. rubrum S1 laboratory lineage provided by the research group of Dirk Schüler (Bayreuth, Germany) that was likely sourced from the American Type Culture Collection in the mid-1960s (hereafter designated as the DS strain). In line with these observations, transmission electron microscopy revealed that the MT strain failed to assemble flagellar filaments, whereas the DS strain showed the characteristic monopolar or bipolar flagellation pattern documented in the literature (Figure 1a; Lee & Fitzsimons, 1976). To identify the genetic basis of this phenotypic difference, we sequenced the genomes of both laboratory strains and compared them to the R. rubrum S1 reference genome (Munk et al., 2011), which is derived from an R. rubrum S1 stock deposited at the American Type Culture Collection (ATCC 11170).
Comparative sequence analysis revealed that both strains deviated from the reference genome at multiple loci (Figure 1b,c). A subset of these variations was strain-specific, whereas 18 mutations were shared, suggesting that genetic drift had already commenced within the culture collection prior to further divergence of the strains during independent maintenance in the respective laboratories. The shared deviations comprise 10 single nucleotide polymorphisms (SNPs). Five are located in intergenic regions, while the remaining five introduce non-synonymous mutations in predicted open reading frames (ORFs), resulting in amino acid substitutions in the putative gene products (see Extended Data). Both strains additionally harbor insertions and deletions that disrupt ORF Rru_A0205 (DnaJ-like protein), fuse Rru_A0341 (CRISPR-associated protein) with Rru_A0342 (uncharacterized), extend the reading frame of Rru_A2352 (uncharacterized) and fuse Rru_A2834 (uncharacterized) with Rru_A2835 (MotB-like protein).
Beyond the shared deviations, the genome of the MT strain exhibited seven unique differences relative to the reference sequence (Figure 1b,c). Six of these are SNPs located either in intergenic regions or within ORFs, where they result in amino acid substitutions. The remaining deviation was a single base-pair insertion within the gene for the flagellar MS-ring protein FliF (Homma et al., 1987; Ueno et al., 1992), which leads to a shift in the reading frame, thereby disrupting FliF function. The MS-ring forms the foundation of the bacterial flagellum, anchoring the motor in the inner membrane and serving as the base for the assembly of structural components such as the flagellar rod and filament (Francis et al., 1992; Kubori et al., 1992; Ueno et al., 1994). The disruption of fliF in the MT strain thus abolishes flagellar biogenesis, in agreement with the lack of flagella observed by electron microscopy (Figure 1a). Notably, flagellar assembly and motility were fully restored by reverting the frameshift mutation in fliF back to the reference genome sequence (Figure 1a), confirming the absence of other mutations deleterious to flagellar motility.
As expected, the DS strain did not show any mutations in motility-related genes, but it stood out due to its high frequency of unique deviations from the reference genome (Figure 1b,c). In total, the strain harbors 79 unique SNPs, with 11 located in intergenic regions and 68 within open reading frames (ORFs). While the majority of the latter result in silent or non-synonymous mutations, three have more severe functional consequences: two introduce nonsense mutations that truncate Rru_A1282 (a VirG-like protein) and Rru_A1603 (a PhoH-like protein), while the third disrupts the start codon of Rru_A2703 (a TrmH-like protein), thereby precluding the formation of the gene product. In addition to SNPs, the DS strain harbors 3 unique deletions, which shorten ORFs Rru_A0918 (histidine kinase) and Rru_A3395 (LuxR-like transcriptional regulator) and introduce a frameshift in Rru_A1277 (histidine kinase), completely disrupting its function. Furthermore, the strain exhibits 4 unique insertions. One is located in an intergenic region, while two others induce frameshifts that disrupt Rru_A1034 (a histidine kinase) and Rru_A1843 (an OmpA/MotB-like protein). Finally, the DS strain is characterized by a 1,416 bp insertion within Rru_A2108 (a histidine kinase). This segment exhibits high similarity (93% coverage; 73.56% identity; E-value 2E-125) to a genomic region in Pararhodospirillum photometricum DSM 122 (positions 1,859,748–1,861,060), suggesting that it was acquired via horizontal gene transfer.
Collectively, these findings illustrate the rapid pace of bacterial genome evolution under laboratory conditions. Common cultivation practices subject bacteria to various selective pressures, such as the demand for rapid planktonic growth in rich media under fixed environmental conditions, the need to withstand extended incubation in stationary phase on nutrient agar plates, and the requirement to survive prolonged cooling and repeated freeze-thaw cycles during strain maintenance. Adaptive mutations can rapidly accumulate during these stress phases and become fixed in subsequent generations. Consistent with this notion, both laboratory strains accumulated mutations in transcriptional regulators and histidine kinases, which are critical for environmental stress sensing and adaptation. To mitigate the selection of genomic variants, new strains should be cryopreserved at the earliest opportunity after their isolation, keeping the number of serial passages to a minimum. Moreover, practices such as the long-term storage of cultures in stationary phase at room temperature, which are still commonly encountered for photosynthetic bacteria, should be strictly avoided.
Our data demonstrate that, despite sharing the same origin, R. rubrum S1 laboratory and repository strains commonly used in research and biotechnology have diverged significantly over the past decades. The variations in their genomic sequences represent a critical factor that should be carefully considered when comparing experimental results obtained with strains from different lineages.
","references":[{"reference":"Cserti E, Rosskopf S, Chang YW, Eisheuer S, Selter L, Shi J, et al., Thanbichler. 2017. Dynamics of the peptidoglycan biosynthetic machinery in the stalked budding bacterium Hyphomonas neptunium. Molecular Microbiology 103: 875-895.
","pubmedId":"","doi":"10.1111/mmi.13593"},{"reference":"Francis NR, Irikura VM, Yamaguchi S, DeRosier DJ, Macnab RM. 1992. Localization of the Salmonella typhimurium flagellar switch protein FliG to the cytoplasmic M-ring face of the basal body. Proceedings of the National Academy of Sciences USA 89: 6304-6308.
","pubmedId":"","doi":"10.1073/PNAS.89.14.6304"},{"reference":"Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6: 343-345.
","pubmedId":"","doi":"10.1038/nmeth.1318"},{"reference":"Homma M, Aizawa S, Dean GE, Macnab RM. 1987. Identification of the M-ring protein of the flagellar motor of Salmonella typhimurium. Proceedings of the National Academy of Sciences USA 84: 7483-7487.
","pubmedId":"","doi":"10.1073/PNAS.84.21.7483"},{"reference":"Jung A, Eisheuer S, Cserti E, Leicht O, Strobel W, Möll A, et al., Thanbichler. 2015. Molecular toolbox for genetic manipulation of the stalked budding bacterium Hyphomonas neptunium. Applied and Environmental Microbiology 81: 736-744.
","pubmedId":"","doi":"10.1128/AEM.03104-14"},{"reference":"Knöppel A, Knopp M, Albrecht LM, Lundin E, Lustig U, Näsvall J, Andersson DI. 2018. Genetic adaptation to growth under laboratory conditions in Escherichia coli and Salmonella enterica. Frontiers in Microbiology 9: 10.3389/fmicb.2018.00756.
","pubmedId":"","doi":"10.3389/FMICB.2018.00756"},{"reference":"Kram KE, Geiger C, Ismail WM, Lee H, Tang H, Foster PL, Finkel SE. 2017. Adaptation of Escherichia coli to long-term serial passage in complex medium: evidence of parallel evolution. mSystems 2: 10.1128/msystems.00192-16.
","pubmedId":"","doi":"10.1128/MSYSTEMS.00192-16"},{"reference":"Kubori T, Shimamoto N, Yamaguchi S, Namba K, Aizawa SI. 1992. Morphological pathway of flagellar assembly in Salmonella typhimurium. Journal of Molecular Biology 226: 433-446.
","pubmedId":"","doi":"10.1016/0022-2836(92)90958-M"},{"reference":"Lee AG, Fitzsimons JTR. 1976. Motility in normal and filamentous forms of Rhodospirillum rubrum. Journal of General Microbiology 93: 346-354.
","pubmedId":"","doi":"10.1099/00221287-93-2-346"},{"reference":"Marks ME, Castro-Rojas CM, Teiling C, Du L, Kapatral V, Walunas TL, Crosson S. 2010. The genetic basis of laboratory adaptation in Caulobacter crescentus. Journal of Bacteriology 192: 3678-3688.
","pubmedId":"","doi":"10.1128/JB.00255-10"},{"reference":"Molisch H (1907) Die Purpurbakterien nach neuen Untersuchungen I-VII. Gustav Fischer, Jena.
","pubmedId":"","doi":""},{"reference":"Munk AC, Copeland A, Lucas S, Lapidus A, Del Rio TG, Barry K, et al., Schwartz. 2011. Complete genome sequence of Rhodospirillum rubrum type strain (S1T). Standards in Genomic Sciences 4: 293-302.
","pubmedId":"","doi":"10.4056/sigs.1804360"},{"reference":"van Niel CB. 1944. The culture, general physiology, morphology, and classification of the non-sulfur purple and brown bacteria. Bacteriological Reviews 8: 1-118.
","pubmedId":"","doi":"10.1128/br.8.1.1-118.1944"},{"reference":"Pfennig N, Trüper HG. 1971. Type and neotype strains of the species of phototrophic bacteria maintained in pure culture. International Journal of Systematic Bacteriology 21: 19-24.
","pubmedId":"","doi":"10.1099/00207713-21-1-19"},{"reference":"Pöhl S, Giacomelli G, Meyer FM, Kleeberg V, Cohen EJ, Biboy J, et al., Thanbichler. 2024. An outer membrane porin-lipoprotein complex modulates elongasome movement to establish cell curvature in Rhodospirillum rubrum. Nature Communications 15: 7616.
","pubmedId":"","doi":"10.1038/s41467-024-51790-z"},{"reference":"Ratib NR, Seidl F, Ehrenreich IM, Finkel SE. 2021. Evolution in long-term stationary-phase batch culture: emergence of divergent Escherichia coli lineages over 1,200 days. mBio 12: 10.1128/mbio.03337-20.
","pubmedId":"","doi":"10.1128/MBIO.03337-20"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1992. M ring, S ring and proximal rod of the flagellar basal body of Salmonella typhimurium are composed of subunits of a single protein, FliF. Journal of Molecular Biology 227: 672-677.
","pubmedId":"","doi":"10.1016/0022-2836(92)90216-7"},{"reference":"Ueno T, Oosawa K, Aizawa SI. 1994. Domain structures of the MS ring component protein (FliF) of the flagellar basal body of Salmonella typhimurium. Journal of Molecular Biology 236: 546-555.
","pubmedId":"","doi":"10.1006/JMBI.1994.1164"},{"reference":"Zheng Z, Li S, Su J, Leung AWS, Lam TW, Luo R. 2022. Symphonizing pileup and full-alignment for deep learning-based long-read variant calling. Nature Computational Science 2: 797-803.
","pubmedId":"","doi":"10.1038/s43588-022-00387-x"}],"title":"Comparative genomics of Rhodospirillum rubrum S1 lineages reveals significant differences from the reference genome
","reviews":[],"curatorReviews":[]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"79a2f02f-9644-44cf-bc23-04f608cc3d3c","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}