Housekeeping genes are widely used as experimental references for gene expression, yet many exhibit substantial variation within and between cell types. Using Zebrafish Meta Atlas Project (ZMAP), we found eef1a1l1 to be ubiquitously and highly expressed across zebrafish embryonic cell types, developmental stages, and studies. Transgenic reporters based on its upstream sequence drove broad embryonic expression, and single-cell profiling revealed that reporter levels covary with endogenous eef1a1l1 transcripts. These findings support the use of eef1a1l1 as a reference for embryonic gene expression and demonstrate the utility of its regulatory promoter as a practical, multi-purpose transgenic driver.
","acknowledgements":"The authors thank Sean Megason, Andrew Murphy, and the Wagner Lab at UCSF for feedback and discussions. Additionally, we thank Kelsey Voge and Krista Zimmerman at Janelia Research Campus for help with zebrafish injections, screening and sperm genotyping of potential founders.
","authors":[{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["writing_reviewEditing","investigation"],"email":"Nicole.AponteSantiago@ucsf.edu","firstName":"Nicole A. ","lastName":"Aponte-Santiago","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["methodology","investigation","writing_reviewEditing"],"email":"Nicole.Suren@ucsf.edu","firstName":"Nicole","lastName":"Suren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["formalAnalysis"],"email":"Yingxin.Su@ucsf.edu","firstName":"Yingxin","lastName":"Su","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation"],"email":"coralh@berkeley.edu","firstName":"Coral N. ","lastName":"Halanych","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Janelia Research Campus, Ashburn, VA, United States"],"departments":[""],"credit":["investigation"],"email":"songe@janelia.hhmi.org","firstName":"Erin ","lastName":"Song","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["methodology","supervision","writing_reviewEditing"],"email":"swinburne@berkeley.edu","firstName":"Ian A. ","lastName":"Swinburne","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation","methodology","writing_reviewEditing"],"email":"dqmatus@berkeley.edu","firstName":"David Q. ","lastName":"Matus","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["conceptualization","writing_originalDraft","writing_reviewEditing","supervision","investigation","methodology","fundingAcquisition"],"email":"Daniel.Wagner@ucsf.edu","firstName":"Daniel E. ","lastName":"Wagner","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2983-635X"}],"awards":[{"awardId":"","funderName":"CZ Biohub SF (United States)","awardRecipient":"Daniel E. Wagner"},{"awardId":"DP2GM146258 ","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Daniel E. Wagner"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table 1. Top 200 candidate housekeeping genes
Genes were identified from ZMAP by filtering for normalized dispersion < 0 and ranked by mean log transformed TPM expression. Columns include expression rank, gene symbol, mean log-TPM, normalized dispersion, Ensembl gene ID, RefSeq mRNA accession, functional category (manually assigned), and full gene name. Data for the top 200 ranked candidate genes are reported. The top 30 genes (ranks 1–30) satisfied both the stability criterion and high expression abundance (top 0.1% of all transcripts).
","doi":null,"resourceType":"Text","name":"Extended_Data_Table1.csv","url":"https://portal.micropublication.org/uploads/c7740bf41705c9de739e18b13160c304.csv"}],"funding":"This work was supported by DP2GM146258 and a Chan Zuckerberg Biohub Investigator award.
","image":{"url":"https://portal.micropublication.org/uploads/33840da1c2591188b14403223ea35bd3.png"},"imageCaption":"(A) Left, scatterplot of normalized dispersion versus log-transformed mean TPM (transcripts per million counts) expression for all genes in ZMAP. Genes are colored by classification criteria: stable (normalized dispersion values < 0, blue), abundant (top 0.1% of mean expression, red), and stable + abundant (satisfying both criteria, magenta). Select labels for routinely used housekeeping genes are shown. Right, The top candidate housekeeping genes, jointly ranked by dispersion and abundance, along with RefSeq IDs. (B) UMAP overlay of eef1a1l1 transcript counts expressed as log-normalized TPM counts, showing high and broadly distributed expression across cells. Comparisons to additional housekeeping references are shown. (C) Dot plot of eef1a1l1 expression across CellType groups, stratified by developmental time window (left) and contributing study (right). Dot color and size reflect average expression and fraction of expressing cells, respectively. Omitted groups with insufficient cell numbers (<10 cells or <1% of the group’s total representation in the integrated dataset) are depicted as small gray circles. (D) Representative confocal maximum-intensity projection of a live Tg(eef1a1l1-2.2kb:h2b-mCherry2) embryo at 24 hours post-fertilization (hpf). Nuclear mCherry signal is observed across diverse tissues. Scale bar, 200 µm. Labels indicate major anatomical structures: fb (forebrain), mb (midbrain), mhb (midbrain-hindbrain boundary), hb (hindbrain), evl (enveloping layer), ot (otic vesicle), ret (retina), len (lens), hg (hatching gland), ysl (yolk syncytial layer), som (somites), tb (tailbud), and sc (spinal cord). (E) Projection of an inDrops scRNA-seq dataset generated from Tg(eef1a1l1-2.2kb:h2b-mCherry2) embryos onto the ZMAP reference using the zmap-tools annotation pipeline. A total of 5,227 cells were annotated. Assigned labels localize to clustered regions of the reference UMAP. (F) Relationship between endogenous eef1a1l1 expression and transgenic mCherry2 mRNA levels across 15 selected CellType groups, showing linear correspondence in log-transformed raw counts. (G) Representative spinning disk confocal optical sections of live Tg(p14a.eef1a1|1-2.2kb:mStayGold:sec61b (left) and p14a.eef1a1|1-2.6kb:mStayGold:sec61b (right) embryos at 24 hpf of the somites, notochord and spinal cord (left) and eye (right). Scale bar, 100 µm. (H) Quantification of n>30 images of each allele, n.s. not significant, p = 0.37 Students t-test).
","imageTitle":"Identification and validation of eef1a1l1 as a broadly expressed housekeeping gene
","methods":"Acquisition of Public scRNAseq Data
Processed scRNAseq data were obtained from the Zebrafish Meta Atlas Project (ZMAP; https://wagnerlabucsf.github.io/zmap/), which comprises the following public datasets: Farrell et al 2018 (Farrell et al., 2018) (GEO: GSE106474, BioProject: PRJNA417290), Sur et al 2023 (Sur et al., 2023) (GEO: GSE223922, BioProject: PRJNA929041), Wagner et al 2018 (Wagner et al., 2018) (GEO: GSE112294, BioProject: PRJNA445487), Kukreja et al 2024 (Kukreja et al., 2024) (GEO: GSE269784, BioProject: PRJNA1123686), Farnsworth et al 2020 (Farnsworth et al., 2020) (BioProject: PRJNA564810), Lange et al 2023 (Lange et al., 2024) (BioProject: PRJNA940501), Spanjaard et al, 2018 (Spanjaard et al., 2018) (GEO: GSE81533, BioProject: PRJNA321866), and Kamimoto et al 2023 (Kamimoto et al., 2023) (GEO: GSE145298, BioProject: PRJNA606682). Additional public inDrops scRNAseq data were obtained from (GEO: GSE326623, BioProject: PRJNA1446332).
Generation of Tg(eef1a1l1-2.2kb:h2b-mCherry2)
Using primers indicated below, a ~2.2 kb genomic region upstream of the predicted eef1a1l1 translation start site was amplified from purified zebrafish genomic DNA using Phusion polymerase. PCR cycling conditions: 98°C for 1 min; 35 cycles of 98°C for 10 s and 72°C for 3 min; followed by 72°C for 5 min. In parallel, a pMTB vector backbone containing superfolder GFP (Addgene #112225) was amplified using Phusion polymerase with cycling conditions of 98°C for 1 min; 35 cycles of 98°C for 10 s, 64°C for 30 s, and 72°C for 3 min; followed by 72°C for 5 min. These two amplicon fragments were then joined by isothermal assembly to replace the pMTB actb2 promoter with that of eef1a1l1, yielding Tg(eef1a1l1:sfGFP). The eef1a1l1 promoter was subsequently subcloned to generate Tg(eef1a1l1-2.2kb:h2b-mCherry2) via a 3-fragment NEB HiFi DNA assembly. All fragments were amplified from either Tg(eef1a1l1:sfGFP) or pMTB-h2b-mCherry using Q5 polymerase using: 98°C for 30 s; 5 cycles of 98°C for 10 s, 62-65°C for 30 s, and 72°C for 2 min; followed by 30 cycles of 98°C for 10 s, 65-72°C for 30 s, and 72°C for 2 min; with a final extension at 72°C for 2 min. The fully assembled Tg(eef1a1l1-2.2kb:h2b-mCherry2) was used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with Tol2 mRNA (50 ng/µL) (Kawakami & Shima, 1999) and plasmid DNA (10 ng/µL). Transgenic founders were identified by live fluorescence imaging. Primer sequences used for cloning the ~2.2 kb genomic region upstream of eef1a1l1 (NM_131263) are as follows: eef1a1l1, F: GGCCAAAGGTTTGACAACAT, R: GATTGATAAGTTTCTGCGGAC.
Generation of pIGLET Transgenics
To add the extended ~2.6kb eef1a1|1 promoter to plasmids, we synthesized (Twist Biosciences) the predicted region from the zfin genome annotation of the eef1a1|1 locus. As the predicted sequence included the first exon, we changed two possible Methionine ATGs to AGG to prevent potential translation of a truncated EEF1A1|1 product. This synthesized fragment was subcloned into a plasmid that already contained the ~2.2kb driver, to be used for downstream subcloning. To generate plasmids MGCO-04 (2.2kb version) and MGCO-27 (2.6kb version) of mStayGold:sec61b constructs, we synthesized at Twist Biosciences an iCodon (Diez et al., 2022) (https://bazzinilab.shinyapps.io/icodon/) optimized of sec61b based on the Sec61 amino acid sequence from the Davidson collection plasmid pmApple-Sec61-C-18 (Tsuda et al., 2023) with overhangs for NEBuilder HiFi DNA assembly cloning (NEB). First, we added the mStayGold c4 linker (Hirano et al., 2022) to a base plasmid (pDQM102) with a 2.2kb eef1a1|1:mStayGold insert using a KLD mutagenesis reaction with primers, C4-KLD-F AGCGCGAGTGCTGTAGGAGCCTCCGGAGCCTCCG, and C4-KLD-R AGGTTCATGCCAGGGCAAGTGAGCCTCCAGGGTTTCG. Next, to generate plasmid MGCO-04 we performed an NEBuilder HiFi DNA assembly reaction with PCR-amplified backbone using primers, 3p-linker-DQM-SV40-F taaatcgatgatgatccagacatgataag and 3p-linker-DQM-R TGGCGCGCCGGAGGCTC and the synthesized sec61b block. To add the additional eef1a1|1 promoter sequence to generate MGCO-27, we amplified the backbone of MGCO-04 using primers pDQM-ef1a-extraF tttgttaatcAGgccgccacCATGGGAGCATCGGG and pDQM-ef1a-extra-R ccgtaatgactaggccctcgag and primers pDQM133-ef1a-exonF cggctcgagggcctagtcattac and pDQM133-ef1a-exon-R CCATGgtggcggcCTgattaa. Plasmid sequence was verified by whole plasmid sequencing. Plasmids MGCO-04 and MGCO-27 were used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with PhiC31 mRNA (25 ng/ul) and plasmid DNA (25 ng/ul). Transgenic founders were identified by PCR screening of sperm followed up by live fluorescence imaging. Genotyping to confirm integration was performed using the following primers: DM323 CCTAGCGCGAGTGCTGT and DM320 CTGACTGCGTCACTTTGACAC for insertion at the pIGLET14 locus and DM235 acaccgtcttactctaaagaaacacg and DM387 CCATATCTCCAGTCAGAACAG to confirm the amplicon difference between the ~2.2kb and ~2.6kb promoter.
Confocal Microscopy and Image Quantification
Imaging data for the Tol2-based Tg(2.2kb:eef1a1l1-2.2kb:h2b-mCherry2) (Fig. 1D) was collected on a Leica Stellaris 5 scanning confocal microscope. Shown is a tiled maximum intensity projection collected using an HC PL APO L 10x/0.40 CS2 objective (Leica). Imaging data for the phiC31-based pIGLET alleles Tg(p14a.2.2kb:eef1a1|1-2.2kb:mStayGold-sec61b) and Tg(p14a.2.6kb:eef1a1|1-2.2kb:mStayGold-sec61b) (Fig. 1G) was collected on a Yokogawa X Spinning Disk confocal microscope on a Nikon TiE frame using a Hamamatsu EM-CCD camera. Shown are representative single optical sections collected using a 20X/xx objective (Nikon). Images were quantified in ImageJ (Schindelin et al., 2012) by auto-selecting regions of fluorescence signal in thresholded images and measuring mean intensity. Background subtraction was performed for each image by measuring the mean intensity a ~21x21 pixel ROI in the darkest part of the image outside of the embryo and subtracting this value from the signal in each image. Data were plotted using PlotsOfData (Postma & Goedhart, 2019).
","reagents":"Plasmids containing driver sequences used to generate the Tol2 (2.2 kb) pIGLET (2.6 kb) alleles will be deposited and available via Addgene. Transgenic zebrafish lines are available upon request.
","patternDescription":"Housekeeping genes are widely used as reference controls for gene expression and transcriptomic analyses, yet many such genes exhibit variable expression across cell types. Whole-embryo single-cell RNA sequencing (scRNA-seq) datasets provide a unique opportunity to identify robust housekeeping markers by leveraging empirical measures of expression stability across cells. Here, we interrogated ZMAP, a scRNA-seq meta-atlas of zebrafish development (Aponte-Santiago et al., 2026), to identify genes that were both stably and abundantly expressed across embryonic and larval cell types, developmental stages, and independent studies. ZMAP comprises 798,790 cells, eight independently published datasets from multiple laboratories (Farnsworth et al., 2020; Farrell et al., 2018; Kamimoto et al., 2023; Kukreja et al., 2024; Lange et al., 2024; Spanjaard et al., 2018; Sur et al., 2023; Wagner et al., 2018), and a range of different single-cell capture and sequencing technologies. These features of ZMAP thus enable the extraction of core signatures of transcriptional stability that generalize beyond any single timepoint, platform, or study of origin.
To identify and rank candidate housekeeping genes, we jointly interrogated the normalized dispersion and global mean expression levels calculated across all 36,365 transcripts represented within ZMAP (Extended Data Table 1). A total of 30 genes satisfied criteria for both stability (normalized dispersion < 0) and high expression (top 0.1%) (Fig. 1A). Amongst these 30 genes, the majority (27/30) encoded ribosomal proteins; eef1a1l1, which encodes a highly expressed translation elongation factor 1-alpha subunit (Ligunas & Materna, 2026), ranked as the top non-ribosomal gene meeting these criteria. Other genes frequently used as ubiquitous references and/or transgenic drivers in zebrafish, including ubiquitin B (ubb), beta actin 2 (actb2), and glyceraldehyde-3-phosphate dehydrogenase (gapdh) (Choe et al., 2021; Mosimann et al., 2011), satisfied only one (or neither) of these criteria, indicating that eef1a1l1 represents a particularly stable and abundant transcriptional reference. We next compared the expression of these genes across the ZMAP reference embedding and confirmed high relative expression, broadly distributed across cells throughout the developmental manifold, for eef1a1l1 (Fig. 1B). Expression of eef1a1l1 was further examined across all ZMAP “CellType” annotation groups (n=76), stratified by both developmental timepoint and originating study (Fig. 1C). Across both stratifications, eef1a1l1 exhibited high average expression and a large fraction of expressing cells in all groups.
To experimentally validate these expression characteristics, transgenic reporter lines were generated using two candidate regulatory regions: (1) a ~2.2 kb sequence upstream of the eef1a1l1 coding sequence and (2) a ~2.6 kb sequence that also spanned a large H3K4me3 peak centered on the eef1a1l1 transcriptional start site (Baranasic et al., 2022; Gardiner-Garden & Frommer, 1987). Confocal imaging of live embryos carrying Tg(eef1a1l1-2.2kb:h2b-mCherry2) at 24 hours post-fertilization (hpf) revealed reporter signal that spanned multiple tissues and anatomical regions (Fig. 1D). An independent inDrops scRNA-seq dataset comprising 8 biological replicates collected from Tg(eef1a1l1-2.2kb:h2b-mCherry2) embryos at 29 hpf was projected onto the ZMAP reference using the zmap-tools annotation pipeline (Aponte-Santiago et al., 2026), resulting in the annotation of 5,227 transgenic query cells. Projected cells localized to specific regions of the UMAP reference embedding and co-clustered by CellType annotation groups (Fig. 1E). We compared transcript counts for mCherry2 to those of the endogenous eef1a1l1 gene across 15 selected CellType groups that were well-sampled in the query scRNA-seq dataset. Across groups, mCherry2 expression scaled with endogenous eef1a1l1 transcript levels in log1p-transformed raw counts (slope=0.75; Fig. 1F), indicating broad recapitulation of the endogenous expression pattern. For Tg(eef1a1l1-2.2kb:h2b-mCherry2), we noted that absolute mCherry2 counts were approximately 3-4-fold lower than those of endogenous eef1a1l1 in the highest-expressing cells (Fig. 1F). In addition, we observed variable expression intensity and occasional mosaicism amongst independent Tol2 founder lines derived using the 2.2 kb driver sequence. Based on these observations, we conclude that while the 2.2 kb driver can support broad expression, its performance may be sensitive to genomic context and its usage therefore requires careful founder-line screening.
To explore the possibility that additional important cis-regulatory elements lie outside this initial 2.2 kb driver sequence, we compared its performance with that of a longer 2.6 kb driver in the context of a standardized safe harbor locus: phiC31 Integrase Genomic Loci Engineered for Transgenesis 14a (“pIGLET14a”) (Lalonde et al., 2024), using a monomeric StayGold fluorescent reporter (Tschanz et al., 2025) localized to the ER membrane (mSG:sec61b) (Diez et al., 2022). Live imaging of heterozygous Tg(p14a.eef1a1l1-2.2kb:mSG:sec61b) or Tg(p14a.eef1a1l1-2.6kb:mSG:sec61b) carriers at 24 hpf revealed uniform localization across cells and tissues in both transgenic lines (Fig. 1G), and quantification across single confocal planes revealed no significant differences in expression levels (Fig. 1H). Thus, at the pIGLET14a locus, the 2.2 kb and 2.6 kb drivers appear to perform similarly with respect to overall expression level and tissue distribution. For future work, we recommend use of the extended 2.6kb driver, as it may be less sensitive to within-allele mosaicism and/or position effects observed in some Tol2 lines generated with the 2.2kb driver.
To support community usage, plasmids and stable transgenic zebrafish lines generated in this study will be made available through Addgene and/or by direct request. Together, these findings support the use of eef1a1l1 as a stable endogenous reference for zebrafish embryonic gene expression and demonstrate the use of its upstream regulatory sequence as a practical driver for broad transgene expression.
","references":[{"reference":"Aponte Santiago NA, Su Y, Wagner DE. 2026. ZMAP: A single-cell meta-atlas of zebrafish embryonic development reveals. bioRxiv","pubmedId":"","doi":"10.64898/2026.03.23.713599"},{"reference":"Farrell JA, Wang Y, Riesenfeld SJ, Shekhar K, Regev A, Schier AF. 2018. Single-cell reconstruction of developmental trajectories during zebrafish. Science. 360","pubmedId":"","doi":"10.1126/science.aar3131"},{"reference":"Sur A, Wang Y, Capar P, Margolin G, Prochaska MK, Farrell JA. 2023. Single-cell analysis of shared signatures and transcriptional diversity. Dev. Cell. 58: 3028-3047.e12.","pubmedId":"","doi":"10.1016/j.devcel.2023.11.001"},{"reference":"Wagner DE, Weinreb C, Collins ZM, Briggs JA, Megason SG, Klein AM. 2018. Single-cell mapping of gene expression landscapes and lineage in the. Science. 360: 981-987.","pubmedId":"","doi":"10.1126/science.aar4362"},{"reference":"Kukreja K, Jia BZ, Mc Geary SE, Patel N, Megason SG, Klein AM. 2024. Cell state transitions are decoupled from cell division during early. Nat. Cell Biol. 26: 2035-2045.","pubmedId":"","doi":"10.1038/s41556-024-01546-0"},{"reference":"Farnsworth DR, Saunders LM, Miller AC. 2020. A single-cell transcriptome atlas for zebrafish development. Dev. Biol. 459: 100-108.","pubmedId":"","doi":"10.1016/j.ydbio.2019.11.008"},{"reference":"Lange M, Granados A, Vijay Kumar S, Bragantini J, Ancheta S, Kim YJ, et al., Royer LA. 2024. A multimodal zebrafish developmental atlas reveals the state-transition. Cell. 187: 6742-6759.e17.","pubmedId":"","doi":"10.1016/j.cell.2024.09.047"},{"reference":"Spanjaard B, Hu B, Mitic N, Olivares Chauvet P, Janjuha S, Ninov N, Junker JP. 2018. Simultaneous lineage tracing and cell-type identification using. Nat. Biotechnol. 36: 469-473.","pubmedId":"","doi":"10.1038/nbt.4124"},{"reference":"Kamimoto K, Stringa B, Hoffmann CM, Jindal K, Solnica Krezel L, Morris SA. 2023. Dissecting cell identity via network inference and in silico gene. Nature. 614: 742-751.","pubmedId":"","doi":"10.1038/s41586-022-05688-9"},{"reference":"Ligunas GD, Materna SC. 2026. Quantification of eef1a1l1 transcript in early zebrafish development. MicroPubl. Biol. 2026","pubmedId":"","doi":"10.17912/micropub.biology.001944"},{"reference":"Choe CP, Choi SY, Kee Y, Kim MJ, Kim SH, Lee Y, Park HC, Ro H. 2021. Transgenic fluorescent zebrafish lines that have revolutionized biomedical. Lab. Anim. Res. 37: 26.","pubmedId":"","doi":"10.1186/s42826-021-00103-2"},{"reference":"Mosimann C, Kaufman CK, Li P, Pugach EK, Tamplin OJ, Zon LI. 2011. Ubiquitous transgene expression and Cre-based recombination driven by the. Development. 138: 169-177.","pubmedId":"","doi":"10.1242/dev.059345"},{"reference":"Gardiner Garden M, Frommer M. 1987. CpG islands in vertebrate genomes. J. Mol. Biol. 196: 261-282.","pubmedId":"","doi":"10.1016/0022-2836(87)90689-9"},{"reference":"Baranasic D, Hortenhuber M, Balwierz PJ, Zehnder T, Mukarram AK, Nepal C, et al., Muller F. 2022. Multiomic atlas with functional stratification and developmental dynamics. Nat. Genet. 54: 1037-1050.","pubmedId":"","doi":"10.1038/s41588-022-01089-w"},{"reference":"Lalonde RL, Wells HH, Kemmler CL, Nieuwenhuize S, Lerma R, Burger A, Mosimann C. 2024. pIGLET: Safe harbor landing sites for reproducible and efficient. Sci. Adv. 10: eadn6603.","pubmedId":"","doi":"10.1126/sciadv.adn6603"},{"reference":"Tschanz A, Matus DQ, Swinburne I. 2025. Systematic comparison of mStayGold and mGold2 variants for live imaging in. MicroPubl. Biol. 2025","pubmedId":"","doi":"10.17912/micropub.biology.001847"},{"reference":"Diez M, Medina Munoz SG, Castellano LA, Da Silva Pescador G, Wu Q, Bazzini AA. 2022. iCodon customizes gene expression based on the codon composition. Sci. Rep. 12: 12126.","pubmedId":"","doi":"10.1038/s41598-022-15526-7"},{"reference":"Kawakami K, Shima A. 1999. Identification of the Tol2 transposase of the medaka fish Oryzias latipes. Gene. 240: 239-244.","pubmedId":"","doi":"10.1016/s0378-1119(99)00444-8"},{"reference":"Tsuda N, Fukagawa R, Sueda S. 2023. Does the nuclear envelope retain its identity during mitosis?. FEBS Lett. 597: 682-692.","pubmedId":"","doi":"10.1002/1873-3468.14568"},{"reference":"Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, et al., Miyawaki A. 2022. A highly photostable and bright green fluorescent protein. Nat. Biotechnol. 40: 1132-1142.","pubmedId":"","doi":"10.1038/s41587-022-01278-2"},{"reference":"Schindelin J, Arganda Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona A. 2012. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 9: 676-682.","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Postma M, Goedhart J. 2019. PlotsOfData-A web app for visualizing data together with their summaries. PLoS Biol. 17: e3000202.","pubmedId":"","doi":"10.1371/journal.pbio.3000202"}],"title":"
Identification of eef1a1l1 as a broadly expressed housekeeping gene and the utility of its promoter as a transgenic driver in developing zebrafish
","reviews":[{"reviewer":{"displayName":"Stefan Materna"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]},{"id":"a5710f0e-2a60-43aa-bb24-4b029242af60","decision":"revise","abstract":"Housekeeping genes are widely used as experimental references for gene expression, yet many exhibit substantial variation within and between cell types. Using Zebrafish Meta Atlas Project (ZMAP), we found eef1a1l1 to be ubiquitously and highly expressed across zebrafish embryonic cell types, developmental stages, and studies. Transgenic reporters driven by 2.2-kb or 2.6-kb eef1a1l1-derived regulatory sequences showed broad embryonic expression, and single-cell profiling revealed that reporter abundance covaried with that of the endogenous eef1a1l1 transcript. These findings further support eef1a1l1 as a reference for embryonic gene expression and the use of its regulatory sequence as a practical, multipurpose transgenic driver.
","acknowledgements":"The authors thank Sean Megason and the Wagner Lab at UCSF for feedback and discussions and Velat Kilic at UC Berkeley for code review. Additionally, we thank Kelsey Voge and Krista Zimmerman at Janelia Research Campus for help with zebrafish injections, screening and sperm genotyping of potential founders.
","authors":[{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["writing_reviewEditing","investigation"],"email":"Nicole.AponteSantiago@ucsf.edu","firstName":"Nicole A. ","lastName":"Aponte-Santiago","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["methodology","investigation","writing_reviewEditing"],"email":"Nicole.Suren@ucsf.edu","firstName":"Nicole","lastName":"Suren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["formalAnalysis"],"email":"Yingxin.Su@ucsf.edu","firstName":"Yingxin","lastName":"Su","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation"],"email":"coralh@berkeley.edu","firstName":"Coral N. ","lastName":"Halanych","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation"],"email":"matubrew@smith.edu","firstName":"Maile N.","lastName":"Matubrew","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Janelia Research Campus, Ashburn, VA, United States"],"departments":[""],"credit":["investigation"],"email":"songe@janelia.hhmi.org","firstName":"Erin ","lastName":"Song","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["methodology","supervision","writing_reviewEditing"],"email":"swinburne@berkeley.edu","firstName":"Ian A. ","lastName":"Swinburne","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation","methodology","writing_reviewEditing"],"email":"dqmatus@berkeley.edu","firstName":"David Q. ","lastName":"Matus","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["conceptualization","writing_originalDraft","writing_reviewEditing","supervision","investigation","methodology","fundingAcquisition"],"email":"Daniel.Wagner@ucsf.edu","firstName":"Daniel E. ","lastName":"Wagner","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2983-635X"}],"awards":[{"awardId":"","funderName":"CZ Biohub SF (United States)","awardRecipient":"Daniel E. Wagner"},{"awardId":"DP2GM146258 ","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Daniel E. Wagner"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table 1. Top 200 candidate housekeeping genes
Genes were identified from ZMAP by filtering for normalized dispersion < 0 and ranked by mean log transformed TPM expression. Columns include expression rank, gene symbol, mean log-TPM, normalized dispersion, Ensembl gene ID, RefSeq mRNA accession, functional category (manually assigned), and full gene name. Data for the top 200 ranked candidate genes are reported. The top 30 genes (ranks 1–30) satisfied both the stability criterion and high expression abundance (top 0.1% of all transcripts).
","doi":null,"resourceType":"Text","name":"Extended_Data_Table1.csv","url":"https://portal.micropublication.org/uploads/c7740bf41705c9de739e18b13160c304.csv"}],"funding":"This work was supported by DP2GM146258 and a Chan Zuckerberg Biohub Investigator award.
","image":{"url":"https://portal.micropublication.org/uploads/9edfc53e35f03c44cc66e52d63bdc5f3.png"},"imageCaption":"(A) Left, scatterplot of normalized dispersion versus log-transformed mean TPM (transcripts per million counts) expression for all genes in ZMAP. Genes are colored by classification criteria: stable (normalized dispersion values < 0, blue), abundant (top 0.1% of mean expression, red), and stable + abundant (satisfying both criteria, magenta). Labels for example housekeeping genes are shown. Right, top candidate housekeeping genes, jointly ranked by dispersion and abundance (see also Extended Data Table 1).
(B) UMAP overlay of eef1a1l1 transcript counts expressed as log-normalized TPM counts, showing high and broadly distributed expression across cells.
(C) Dot plot of eef1a1l1 expression across CellType groups, stratified by developmental time window (left) and contributing study (right). Dot color and size reflect average expression and fraction of expressing cells, respectively. Omitted groups with insufficient cell numbers (<10 cells or <1% of the group’s total representation in the integrated dataset) are depicted as gray circles.
(D) Construct design (not to scale). Transcription start site (TSS), ATG start codon, and genomic positions (GRCz11) are indicated.
(E) Representative confocal maximum-intensity projection of a live Tg(2.2eef1a1l1:h2b-mCherry2) embryo at 24 hours post-fertilization (hpf). Nuclear mCherry signal is observed across diverse tissues. Scale bar, 200 µm. Labels indicate major anatomical structures: fb (forebrain), mb (midbrain), mhb (midbrain-hindbrain boundary), hb (hindbrain), evl (enveloping layer), ot (otic vesicle), ret (retina), len (lens), hg (hatching gland), ysl (yolk syncytial layer), som (somites), tb (tailbud), and sc (spinal cord).
(F) Projection of an inDrops scRNA-seq dataset generated from Tg(2.2eef1a1l1:h2b-mCherry2) embryos onto the ZMAP reference using the zmap-tools annotation pipeline. A total of 8,587 cells were annotated. Assigned labels (n=46) are indicated and colored according to germ layer groupings.
(G) Pseudobulk mean raw counts per annotated cell type (n=46) for mCherry2 and eef1a1l1. Point size scales with log10 cell number per group; colors as in (F). Dashed line, linear regression fit. Inset: Spearman's rho (ρ), P-value, log-log slope and R2. Table: Spearman’s rho against eef1a1l1 for mCherry and indicated control genes.
(H) Representative spinning disk confocal maximum-intensity projections of live Tg(p14a.2.2eef1a1l1:mSG-sec61b) (left) and Tg(p14a.2.6eef1a1l1:mSG-sec61b) (right) embryos at 72 hpf of the trunk/flank musculature just posterior to the yolk extension. Scale bar, 100 µm.
(I) Quantification of n>17 projections per allele, n.s. not significant, p = 0.26 Mann–Whitney test).
","imageTitle":"Evaluation of eef1a1l1 as a broadly expressed housekeeping gene
","methods":"Analysis of scRNA-seq Data
Processed scRNA-seq data were obtained from the Zebrafish Meta Atlas Project (ZMAP) (Aponte-Santiago et al. 2026), which comprises PRJNA417290, PRJNA929041, PRJNA445487, PRJNA1123686, PRJNA564810, PRJNA940501, PRJNA321866, and PRJNA606682. Additional public inDrops scRNA-seq data were obtained from GSE326623 (PRJNA1446332). Analyses used zmap-tools [v0.2.2.2], scanpy [v1.21.1], scipy [v1.16.3], numpy [v2.0.2], and matplotlib [v3.10.0] in Python [v3.12.13]. Housekeeping gene statistics (normalized dispersion and normalized transcript abundance) were calculated using scanpy.pp.highly_variable_genes and plotted using matplotlib (Fig. 1A). The UMAP embedding and dotplot (Fig. 1B-C) were generated using scanpy.pl.embedding and zmap.dotplot.gene_view, using all cells in the ZMAP reference. zmap-tools was also used to pre-process, project, and annotate scRNA-seq data collected from Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 29 hpf using zmap.predict.annotate_with_zmap (Fig. 1F); annotation was performed at the “CellType” level of the ZMAP ontology and p_thresh was set to 0.5. For pseudobulk correlation analyses (Fig. 1G), cells were grouped by their predicted “CellType” and mean raw UMI counts per cell for each gene were calculated. Concordance between mCherry and eef1a1l1 across cell types was quantified by Spearman's rank correlation (scipy), and by linear regression (numpy) of log10 counts for both genes.
Generation of Tg(2.2eef1a1l1:h2b-mCherry2)
Using primers indicated below, a 2.2-kb genomic fragment upstream of the predicted eef1a1l1 translation start site was amplified from purified zebrafish AB strain genomic DNA using Phusion polymerase. PCR cycling conditions: 98°C for 1 min; 35 cycles of 98°C for 10 s and 72°C for 3 min; followed by 72°C for 5 min. The resulting amplicon was ligated into a pMTB vector backbone containing superfolder GFP (Addgene #112225) to replace the pMTB actb2 promoter with that of eef1a1l1, yielding Tg(2.2eef1a1l1:sfGFP). The eef1a1l1 promoter was subsequently subcloned to generate Tg(2.2eef1a1l1:h2b-mCherry2) via a 3-fragment NEB HiFi DNA assembly. The cloned 2.2-kb regulatory fragment contained an approximately 800-bp deletion within the upstream region relative to the corresponding AB and TU reference genome sequences. The complete experimentally tested sequence is available via Addgene #254876. Tg(2.2eef1a1l1:h2b-mCherry2) was used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with Tol2 mRNA (50 ng/µL) (Kawakami and Shima 1999) and plasmid DNA (10 ng/µL). Transgenic founders were identified by live fluorescence imaging. Primer sequences used for cloning the 2.2-kb fragment upstream of eef1a1l1 (NM_131263) are F: GGCCAAAGGTTTGACAACAT, R: GATTGATAAGTTTCTGCGGAC.
Generation of pIGLET Transgenics
To extend the eef1a1l1 promoter from 2.2 to 2.6 kb, additional sequence predicted from the ZFIN GRCz11 annotation (chr19 43119713-43120103) was synthesized (Twist Biosciences) and subcloned into the 2.2-kb driver plasmid. Because this region included the first exon, a potential translation initiation codon (ATG) was changed to AGG to prevent expression of a truncated eef1a1l1 product. To generate plasmids MGCO-04 (2.2-kb version) and MGCO-27 (2.6-kb version) for mStayGold:sec61b constructs, we synthesized an iCodon-optimized (Diez et al. 2022) (https://bazzinilab.shinyapps.io/icodon/) version of sec61b based on the Sec61 amino acid sequence from the Davidson collection plasmid pmApple-Sec61-C-18 (Tsuda et al. 2023) with overhangs for NEBuilder HiFi DNA assembly cloning (NEB). First, we added the mStayGold c4 linker (Hirano et al. 2022) to a base plasmid (pDQM102) with a 2.2-kb eef1a1l1:mStayGold insert using a KLD mutagenesis reaction with primers, C4-KLD-F AGCGCGAGTGCTGTAGGAGCCTCCGGAGCCTCCG, and C4-KLD-R AGGTTCATGCCAGGGCAAGTGAGCCTCCAGGGTTTCG. Next, to generate plasmid MGCO-04 we performed an NEBuilder HiFi DNA assembly reaction with PCR-amplified backbone using primers, 3p-linker-DQM-SV40-F taaatcgatgatgatccagacatgataag and 3p-linker-DQM-R TGGCGCGCCGGAGGCTC and the synthesized sec61b block. To add the additional eef1a1l1 promoter sequence to generate MGCO-27, we amplified the backbone of MGCO-04 using primers pDQM-ef1a-extraF tttgttaatcAGgccgccacCATGGGAGCATCGGG and pDQM-ef1a-extra-R ccgtaatgactaggccctcgag and primers pDQM133-ef1a-exonF cggctcgagggcctagtcattac and pDQM133-ef1a-exon-R CCATGgtggcggcCTgattaa. Plasmid sequence was verified by whole plasmid sequencing. Plasmids MGCO-04 and MGCO-27 were used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with PhiC31 mRNA (25 ng/ul) and plasmid DNA (25 ng/ul). Transgenic founders were identified by PCR screening of sperm followed up by live fluorescence imaging. Genotyping to confirm integration was performed using the following primers: DM323, CCTAGCGCGAGTGCTGT and DM320, CTGACTGCGTCACTTTGACAC for insertion at the pIGLET14a locus and DM235 acaccgtcttactctaaagaaacacg and DM387 CCATATCTCCAGTCAGAACAG to confirm the amplicon difference between the 2.2-kb and 2.6-kb promoter.
Confocal Microscopy and Image Quantification
Imaging data for the Tol2-based Tg(2.2eef1a1l1:h2b-mCherry2) (Fig. 1E) were collected on a Leica Stellaris 5 scanning confocal microscope. Shown is a tiled maximum intensity projection collected using an HC PL APO L 10x/0.40 CS2 objective (Leica). Imaging data for the phiC31-based pIGLET alleles Tg(p14a.2.2eef1a1l1:mSG-sec61b) and Tg(p14a.2.6eef1a1l1:mSG-sec61b) (Fig. 1H) were collected from heterozygous outcrossed casper embryos reared at 28˚C to 72hpf. Larvae were anesthetized in tricaine and mounted in a glass bottom 96-well dish (Ibidi 89626). Imaging was performed with a Yokogawa X Spinning Disk confocal microscope on a Nikon TiE frame using a Hamamatsu EM-CCD camera. Single channel z-stacks of the trunk/flank musculature just posterior to the yolk extension were acquired with the 488nm laser (100% power, 150 ms). Z-stacks comprised a 60 µm volume sampled every 5 µm, or 13 planes per z-stack. Acquisition settings were identical for all data collection. A single field of view was captured per animal. Background reference acquisitions were collected using identical settings, to capture camera offset and read noise (laser off) and laser-induced background on an empty field of view (laser on). Representative maximum intensity projections are shown in Figure 1H.
Image Quantification and Statistical Analyses
Image analysis was performed in Python 3.12.2 (numpy 2.4.2, scipy 1.17.1, pandas 3.0.0, scikit-image 0.26.0, matplotlib 3.10.9, nd2 0.11.3) using scripts co-authored with Claude Opus 4.8 (Anthropic). A per-pixel total background (mean of the laser-on reference frames) was subtracted and the result clipped at zero for each z-stack. For each z-stack we quantified the mean-over-stack: the mean of all voxels of the background-subtracted stack. This metric is linear (proportional to total signal divided by the number of z-planes), independent of projection choice, and insensitive to the number of optical sections, avoiding the non-linearity and z-plane-count sensitivity of max-intensity-projection means. Per-fish mean-over-stack values were compared between the 2.2 kb (n = 17) and 2.6 kb (n = 30) promoter constructs using a two-sided Mann–Whitney U test (primary), with a Welch *t*-test and Cohen's *d* effect size reported alongside. The two promoter lengths were statistically indistinguishable (482 ± 49 vs 464 ± 37 A.U., mean ± s.d.; Mann–Whitney p = 0.26; Welch *t*-test p = 0.15; Cohen's *d* = −0.43; fold change 0.96X). All analysis code, per-fish measurement tables, and figures are available at https://github.com/dqmatus/piglet14a-sec61b-staygold. The reported statistics and quantification plot can be regenerated from the committed measurement tables with `scripts/reproduce_stats.py` (no raw data required). Raw confocal z-stacks are archived on Zenodo (https://doi.org/10.5281/zenodo.21520506) and support full reproduction including the representative image panels.
","reagents":"Plasmids containing driver sequences used to generate the Tol2 (2.2-kb) and pIGLET (2.6-kb) transgenics are available from Addgene under accession numbers: 254876: Tg(2.2eef1a1l1:h2b-mCherry2); 254877: Tg(2.2eef1a1l1:h2b-mNeonGreen) and 258401: Tg(2.6eef1a1l1:mSG:sec61b). Transgenic zebrafish lines s5001Tg, s5002Tg, bbc459Tg and bbc460Tg are available upon request.
","patternDescription":"Housekeeping genes are widely used as reference controls for gene expression analyses and as transgenic drivers. Across model systems, a relatively small number of such genes have become established for this purpose, owing to broad expression and relative stability across life stages and biological contexts. In zebrafish, commonly used references include ubiquitin B (ubb), beta-actin (actb1; actb2), and glyceraldehyde-3-phosphate dehydrogenase (gapdh) (Burket et al. 2008; Mosimann et al. 2011; Choe et al. 2021). Translation elongation factor 1-alpha 1-like 1 (eef1a1l1) has been repeatedly evaluated against other reference genes and ranks among the most stable across developmental stages and tissues (Tang et al. 2007); sex, tissues, stages, and perturbations (McCurley and Callard 2008; Xu et al. 2016); and across organs in transgenic and wild-type backgrounds (Rassier et al. 2020). Absolute transcript numbers in early embryonic stages have also been reported (Ligunas and Materna 2026). Much of this supporting evidence, however, derives from bulk profiling measurements that cannot resolve whether expression stability is preserved within or between cell types. Whole-embryo single-cell RNA sequencing (scRNA-seq) provides an opportunity to evaluate housekeeping genes using empirical measures of expression abundance and stability across individual cells. Here, we interrogated ZMAP (Aponte-Santiago et al. 2026), a zebrafish scRNA-seq meta-atlas comprising 798,790 cells from eight published datasets (Farrell et al. 2018; Spanjaard et al. 2018; Wagner et al. 2018; Farnsworth et al. 2020; Kamimoto et al. 2023; Sur et al. 2023; Kukreja et al. 2024; Lange et al. 2024) to systematically evaluate gene expression abundance and stability across cell types, developmental stages, and technologies.
To assess housekeeping-like characteristics in an unbiased manner, we compared normalized dispersion and global mean expression across all 36,365 genes in ZMAP (Extended Data Table 1). A total of 30 genes satisfied criteria for both stability (normalized dispersion < 0) and high mean expression across cells (top 0.1%) (Fig. 1A). Among these 30 genes, the majority (27/30) encoded ribosomal proteins. eef1a1l1 ranked as the top non-ribosomal gene meeting both criteria, while other references ubb, actb2, and gapdh satisfied at most one of these criteria. We next confirmed broad, stable eef1a1l1 expression across the ZMAP developmental manifold (Fig. 1B). Across ZMAP cell types stratified by developmental stage and originating study, eef1a1l1 showed high mean expression and was detected in a large fraction of cells (Fig. 1C).
EF1a regulatory elements are widely used as constitutive transgenic drivers across model systems, yet zebrafish eef1a1l1-based reagents remain less extensively developed. Some studies have utilized a Xenopus Ef1a-derived 500-bp driver that was later found to be prone to silencing (Johnson and Krieg 1994; Kawakami et al. 2004; Thummel et al. 2006; Burket et al. 2008). A subsequent line based on 1.4 kb of zebrafish eef1a1l1 upstream sequence drove broad expression, but has not been widely adopted (Moon et al. 2013). Motivated by this gap, we set out to develop additional transgenic reagents based on this locus. We evaluated two candidate transgenic drivers: (1) a 2.2-kb genomic sequence upstream of the endogenous eef1a1l1 start codon, encompassing the promoter, 5′ UTR, and first intron; and (2) a 2.6-kb sequence comprising the same upstream regions and extending into the second intron to encompass a broad H3K4me3 peak (Fig. 1D) (Baranasic et al. 2022).
We first tested the ability of the 2.2-kb construct to drive expression in live embryos using Tol2 transgenics. Live confocal imaging of Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 24 hours post-fertilization (hpf) revealed reporter signals that spanned multiple tissues and anatomical regions (Fig. 1E), demonstrating broad expression activity. To evaluate the 2.2-kb driver at single-cell resolution, we used zmap-tools to annotate an external inDrops scRNA-seq dataset collected from Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 29 hpf (see Methods). Projection onto the ZMAP reference enabled annotation of 8,587 transgenic cells across 46 cell types, each mapping to discrete regions of the UMAP embedding (Fig. 1F). Because raw housekeeping gene counts vary with RNA content, cell size, and transcript capture, we asked whether raw pseudobulked mCherry2 counts scaled with those of endogenous eef1a1l1 across cell types. This analysis revealed a strong positive relationship that was approximately linear in log-transformed counts (Spearman’s ρ=0.77, P=5.4e-10; slope=1.3, R2=0.65) and was stronger than correlations between mCherry2 and actb2, gapdh, or ubb (Fig. 1G). These data demonstrate that reporter transcript abundance driven by the 2.2-kb sequence broadly covaries with that of endogenous eef1a1l1 across diverse embryonic cell types.
We next compared the performance of the 2.2-kb and 2.6-kb drivers using the standardized safe-harbor locus: phiC31 Integrase Genomic Loci Engineered for Transgenesis 14a (“pIGLET14a”) (Lalonde et al. 2024), and an ER-localized monomeric StayGold fluorescent reporter (Diez et al. 2022; Tschanz et al. 2025). Live imaging of heterozygous Tg(p14a.2.2eef1a1l1:mSG-sec61b) or Tg(p14a.2.6eef1a1l1:mSG-sec61b) carriers at 72 hpf revealed broad reporter expression across tissues in both lines (Fig. 1H), with no significant difference in mean fluorescence intensity across confocal z-stacks (Fig. 1I). Thus, at the pIGLET14a locus, both drivers displayed similar performance with respect to overall expression level and tissue distribution.
While both the 2.2-kb and 2.6-kb sequences appear capable of driving broad transgene expression, we recommend the 2.6-kb sequence for future work as it retains a larger portion of the endogenous promoter-associated region. For Tol2-based transgenics, we recommend the evaluation of multiple independent founders to account for integration and founder-specific effects; alternatively, this construct performs well with pIGLET-targeted integration. To support community usage, plasmids generated in this study are available through Addgene, and stable transgenic lines are available by direct request. Together, these findings support the use of eef1a1l1 as a stable endogenous reference for zebrafish embryonic gene expression and further demonstrate the use of its upstream regulatory sequence as a practical and broad transgene driver.
","references":[{"reference":"Aponte Santiago NA, Su Y, Wagner DE. 2026. ZMAP: A single-cell meta-atlas of zebrafish embryonic development reveals. bioRxiv","pubmedId":"","doi":"10.64898/2026.03.23.713599"},{"reference":"Baranasic D, Hortenhuber M, Balwierz PJ, Zehnder T, Mukarram AK, Nepal C, et al., Muller F. 2022. Multiomic atlas with functional stratification and developmental dynamics. Nat. Genet. 54: 1037-1050.","pubmedId":"","doi":"10.1038/s41588-022-01089-w"},{"reference":"Burket CT, Montgomery JE, Thummel R, Kassen SC, La Fave MC, Langenau DM, Zon LI, Hyde DR. 2008. Generation and characterization of transgenic zebrafish lines using. Transgenic Res. 17: 265-279.","pubmedId":"","doi":"10.1007/s11248-007-9152-5"},{"reference":"Choe CP, Choi SY, Kee Y, Kim MJ, Kim SH, Lee Y, Park HC, Ro H. 2021. Transgenic fluorescent zebrafish lines that have revolutionized biomedical. Lab. Anim. Res. 37: 26.","pubmedId":"","doi":"10.1186/s42826-021-00103-2"},{"reference":"Diez M, Medina Munoz SG, Castellano LA, Da Silva Pescador G, Wu Q, Bazzini AA. 2022. iCodon customizes gene expression based on the codon composition. Sci. Rep. 12: 12126.","pubmedId":"","doi":"10.1038/s41598-022-15526-7"},{"reference":"Farnsworth DR, Saunders LM, Miller AC. 2020. A single-cell transcriptome atlas for zebrafish development. Dev. Biol. 459: 100-108.","pubmedId":"","doi":"10.1016/j.ydbio.2019.11.008"},{"reference":"Farrell JA, Wang Y, Riesenfeld SJ, Shekhar K, Regev A, Schier AF. 2018. Single-cell reconstruction of developmental trajectories during zebrafish. Science. 360","pubmedId":"","doi":"10.1126/science.aar3131"},{"reference":"Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, et al., Miyawaki A. 2022. A highly photostable and bright green fluorescent protein. Nat. Biotechnol. 40: 1132-1142.","pubmedId":"","doi":"10.1038/s41587-022-01278-2"},{"reference":"Johnson AD, Krieg PA. 1994. pXeX, a vector for efficient expression of cloned sequences in Xenopus. Gene. 147: 223-226.","pubmedId":"","doi":"10.1016/0378-1119(94)90070-1"},{"reference":"Kamimoto K, Stringa B, Hoffmann CM, Jindal K, Solnica Krezel L, Morris SA. 2023. Dissecting cell identity via network inference and in silico gene. Nature. 614: 742-751.","pubmedId":"","doi":"10.1038/s41586-022-05688-9"},{"reference":"Kawakami K, Shima A. 1999. Identification of the Tol2 transposase of the medaka fish Oryzias latipes. Gene. 240: 239-244.","pubmedId":"","doi":"10.1016/s0378-1119(99)00444-8"},{"reference":"Kawakami K, Takeda H, Kawakami N, Kobayashi M, Matsuda N, Mishina M. 2004. A transposon-mediated gene trap approach identifies developmentally. Dev. Cell. 7: 133-144.","pubmedId":"","doi":"10.1016/j.devcel.2004.06.005"},{"reference":"Kukreja K, Jia BZ, Mc Geary SE, Patel N, Megason SG, Klein AM. 2024. Cell state transitions are decoupled from cell division during early. Nat. Cell Biol. 26: 2035-2045.","pubmedId":"","doi":"10.1038/s41556-024-01546-0"},{"reference":"Lalonde RL, Wells HH, Kemmler CL, Nieuwenhuize S, Lerma R, Burger A, Mosimann C. 2024. pIGLET: Safe harbor landing sites for reproducible and efficient. Sci. Adv. 10: eadn6603.","pubmedId":"","doi":"10.1126/sciadv.adn6603"},{"reference":"Lange M, Granados A, Vijay Kumar S, Bragantini J, Ancheta S, Kim YJ, et al., Royer LA. 2024. A multimodal zebrafish developmental atlas reveals the state-transition. Cell. 187: 6742-6759.e17.","pubmedId":"","doi":"10.1016/j.cell.2024.09.047"},{"reference":"Ligunas GD, Materna SC. 2026. Quantification of eef1a1l1 transcript in early zebrafish development. MicroPubl. Biol. 2026","pubmedId":"","doi":"10.17912/micropub.biology.001944"},{"reference":"Mc Curley AT, Callard GV. 2008. Characterization of housekeeping genes in zebrafish: male-female. BMC Mol. Biol. 9: 102.","pubmedId":"","doi":"10.1186/1471-2199-9-102"},{"reference":"Moon HY, Kim OH, Kim HT, Choi JH, Yeo SY, Kim NS, et al., Kim CH. 2013. Establishment of a transgenic zebrafish EF1α:Kaede for monitoring cell. Fish Shellfish Immunol. 34: 1390-1394.","pubmedId":"","doi":"10.1016/j.fsi.2013.02.021"},{"reference":"Mosimann C, Kaufman CK, Li P, Pugach EK, Tamplin OJ, Zon LI. 2011. Ubiquitous transgene expression and Cre-based recombination driven by the. Development. 138: 169-177.","pubmedId":"","doi":"10.1242/dev.059345"},{"reference":"Rassier GT, Silveira TLR, Remiao MH, Daneluz LO, Martins AWS, Dellagostin EN, et al., Campos VF. 2020. Evaluation of qPCR reference genes in GH-overexpressing transgenic. Sci. Rep. 10: 12692.","pubmedId":"","doi":"10.1038/s41598-020-69423-y"},{"reference":"Spanjaard B, Hu B, Mitic N, Olivares Chauvet P, Janjuha S, Ninov N, Junker JP. 2018. Simultaneous lineage tracing and cell-type identification using. Nat. Biotechnol. 36: 469-473.","pubmedId":"","doi":"10.1038/nbt.4124"},{"reference":"Sur A, Wang Y, Capar P, Margolin G, Prochaska MK, Farrell JA. 2023. Single-cell analysis of shared signatures and transcriptional diversity. Dev. Cell. 58: 3028-3047.e12.","pubmedId":"","doi":"10.1016/j.devcel.2023.11.001"},{"reference":"Tang R, Dodd A, Lai D, Mc Nabb WC, Love DR. 2007. Validation of zebrafish (Danio rerio) reference genes for quantitative. Acta Biochim. Biophys. Sin. (Shanghai). 39: 384-390.","pubmedId":"","doi":"10.1111/j.1745-7270.2007.00283.x"},{"reference":"Thummel R, Burket CT, Hyde DR. 2006. Two different transgenes to study gene silencing and re-expression during. ScientificWorldJournal. 6 Suppl 1: 65-81.","pubmedId":"","doi":"10.1100/tsw.2006.328"},{"reference":"Tschanz A, Matus DQ, Swinburne I. 2025. Systematic comparison of mStayGold and mGold2 variants for live imaging in. MicroPubl. Biol. 2025","pubmedId":"","doi":"10.17912/micropub.biology.001847"},{"reference":"Tsuda N, Fukagawa R, Sueda S. 2023. Does the nuclear envelope retain its identity during mitosis?. FEBS Lett. 597: 682-692.","pubmedId":"","doi":"10.1002/1873-3468.14568"},{"reference":"Wagner DE, Weinreb C, Collins ZM, Briggs JA, Megason SG, Klein AM. 2018. Single-cell mapping of gene expression landscapes and lineage in the. Science. 360: 981-987.","pubmedId":"","doi":"10.1126/science.aar4362"},{"reference":"Xu H, Li C, Zeng Q, Agrawal I, Zhu X, Gong Z. 2016. Genome-wide identification of suitable zebrafish Danio rerio reference. J. Fish Biol. 88: 2095-2110.","pubmedId":"","doi":"10.1111/jfb.12915"}],"title":"Evaluation of eef1a1l1 expression stability and promoter-driven reporter activity during zebrafish development
","reviews":[{"reviewer":{"displayName":"Stefan Materna"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":"1787754867267"}]},{"id":"419a3b0d-88fb-434d-9596-001067990847","decision":"accept","abstract":"Housekeeping genes are widely used as experimental references for gene expression, yet many exhibit substantial variation within and between cell types. Using Zebrafish Meta Atlas Project (ZMAP), we found eef1a1l1 to be ubiquitously and highly expressed across zebrafish embryonic cell types, developmental stages, and studies. Transgenic reporters driven by 2.2-kb or 2.6-kb eef1a1l1-derived regulatory sequences showed broad embryonic expression, and single-cell profiling revealed that reporter abundance covaried with that of the endogenous eef1a1l1 transcript. These findings further support eef1a1l1 as a reference for embryonic gene expression and the use of its regulatory sequence as a practical, multipurpose transgenic driver.
","acknowledgements":"The authors thank Sean Megason and the Wagner Lab at UCSF for feedback and discussions and Velat Kilic at UC Berkeley for code review. Additionally, we thank Kelsey Voge and Krista Zimmerman at Janelia Research Campus for help with zebrafish injections, screening and sperm genotyping of potential founders.
","authors":[{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["writing_reviewEditing","investigation"],"email":"Nicole.AponteSantiago@ucsf.edu","firstName":"Nicole A. ","lastName":"Aponte-Santiago","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["methodology","investigation","writing_reviewEditing"],"email":"Nicole.Suren@ucsf.edu","firstName":"Nicole","lastName":"Suren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["formalAnalysis"],"email":"Yingxin.Su@ucsf.edu","firstName":"Yingxin","lastName":"Su","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation"],"email":"coralh@berkeley.edu","firstName":"Coral N. ","lastName":"Halanych","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation"],"email":"matubrew@smith.edu","firstName":"Maile N.","lastName":"Matubrew","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Janelia Research Campus, Ashburn, VA, United States"],"departments":[""],"credit":["investigation"],"email":"songe@janelia.hhmi.org","firstName":"Erin ","lastName":"Song","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["methodology","supervision","writing_reviewEditing"],"email":"swinburne@berkeley.edu","firstName":"Ian A. ","lastName":"Swinburne","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation","methodology","writing_reviewEditing"],"email":"dqmatus@berkeley.edu","firstName":"David Q. ","lastName":"Matus","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["conceptualization","writing_originalDraft","writing_reviewEditing","supervision","investigation","methodology","fundingAcquisition"],"email":"Daniel.Wagner@ucsf.edu","firstName":"Daniel E. ","lastName":"Wagner","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2983-635X"}],"awards":[{"awardId":"","funderName":"CZ Biohub SF (United States)","awardRecipient":"Daniel E. Wagner"},{"awardId":"DP2GM146258 ","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Daniel E. Wagner"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table 1. Top 200 candidate housekeeping genes
Genes were identified from ZMAP by filtering for normalized dispersion < 0 and ranked by mean log transformed TPM expression. Columns include expression rank, gene symbol, mean log-TPM, normalized dispersion, Ensembl gene ID, RefSeq mRNA accession, functional category (manually assigned), and full gene name. Data for the top 200 ranked candidate genes are reported. The top 30 genes (ranks 1–30) satisfied both the stability criterion and high expression abundance (top 0.1% of all transcripts).
","doi":"10.22002/dpprq-cjx91","resourceType":"Text","name":"Extended_Data_Table1.csv","url":"https://portal.micropublication.org/uploads/c7740bf41705c9de739e18b13160c304.csv"}],"funding":"This work was supported by DP2GM146258 and a Chan Zuckerberg Biohub Investigator award.
","image":{"url":"https://portal.micropublication.org/uploads/9edfc53e35f03c44cc66e52d63bdc5f3.png"},"imageCaption":"(A) Left, scatterplot of normalized dispersion versus log-transformed mean TPM (transcripts per million counts) expression for all genes in ZMAP. Genes are colored by classification criteria: stable (normalized dispersion values < 0, blue), abundant (top 0.1% of mean expression, red), and stable + abundant (satisfying both criteria, magenta). Labels for example housekeeping genes are shown. Right, top candidate housekeeping genes, jointly ranked by dispersion and abundance (see also Extended Data Table 1).
(B) UMAP overlay of eef1a1l1 transcript counts expressed as log-normalized TPM counts, showing high and broadly distributed expression across cells.
(C) Dot plot of eef1a1l1 expression across CellType groups, stratified by developmental time window (left) and contributing study (right). Dot color and size reflect average expression and fraction of expressing cells, respectively. Omitted groups with insufficient cell numbers (<10 cells or <1% of the group’s total representation in the integrated dataset) are depicted as gray circles.
(D) Construct design (not to scale). Transcription start site (TSS), ATG start codon, and genomic positions (GRCz11) are indicated.
(E) Representative confocal maximum-intensity projection of a live Tg(2.2eef1a1l1:h2b-mCherry2) embryo at 24 hours post-fertilization (hpf). Nuclear mCherry signal is observed across diverse tissues. Scale bar, 200 µm. Labels indicate major anatomical structures: fb (forebrain), mb (midbrain), mhb (midbrain-hindbrain boundary), hb (hindbrain), evl (enveloping layer), ot (otic vesicle), ret (retina), len (lens), hg (hatching gland), ysl (yolk syncytial layer), som (somites), tb (tailbud), and sc (spinal cord).
(F) Projection of an inDrops scRNA-seq dataset generated from Tg(2.2eef1a1l1:h2b-mCherry2) embryos onto the ZMAP reference using the zmap-tools annotation pipeline. A total of 8,587 cells were annotated. Assigned labels (n=46) are indicated and colored according to germ layer groupings.
(G) Pseudobulk mean raw counts per annotated cell type (n=46) for mCherry2 and eef1a1l1. Point size scales with log10 cell number per group; colors as in (F). Dashed line, linear regression fit. Inset: Spearman's rho (ρ), P-value, log-log slope and R2. Table: Spearman’s rho against eef1a1l1 for mCherry and indicated control genes.
(H) Representative spinning disk confocal maximum-intensity projections of live Tg(p14a.2.2eef1a1l1:mSG-sec61b) (left) and Tg(p14a.2.6eef1a1l1:mSG-sec61b) (right) embryos at 72 hpf of the trunk/flank musculature just posterior to the yolk extension. Scale bar, 100 µm.
(I) Quantification of n>17 projections per allele, n.s. not significant, p = 0.26 Mann–Whitney test).
","imageTitle":"Evaluation of eef1a1l1 as a broadly expressed housekeeping gene
","methods":"Analysis of scRNA-seq Data
Processed scRNA-seq data were obtained from the Zebrafish Meta Atlas Project (ZMAP) (Aponte-Santiago et al. 2026), which comprises PRJNA417290, PRJNA929041, PRJNA445487, PRJNA1123686, PRJNA564810, PRJNA940501, PRJNA321866, and PRJNA606682. Additional public inDrops scRNA-seq data were obtained from GSE326623 (PRJNA1446332). Analyses used zmap-tools [v0.2.2.2], scanpy [v1.21.1], scipy [v1.16.3], numpy [v2.0.2], and matplotlib [v3.10.0] in Python [v3.12.13]. Housekeeping gene statistics (normalized dispersion and normalized transcript abundance) were calculated using scanpy.pp.highly_variable_genes and plotted using matplotlib (Fig. 1A). The UMAP embedding and dotplot (Fig. 1B-C) were generated using scanpy.pl.embedding and zmap.dotplot.gene_view, using all cells in the ZMAP reference. zmap-tools was also used to pre-process, project, and annotate scRNA-seq data collected from Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 29 hpf using zmap.predict.annotate_with_zmap (Fig. 1F); annotation was performed at the “CellType” level of the ZMAP ontology and p_thresh was set to 0.5. For pseudobulk correlation analyses (Fig. 1G), cells were grouped by their predicted “CellType” and mean raw UMI counts per cell for each gene were calculated. Concordance between mCherry and eef1a1l1 across cell types was quantified by Spearman's rank correlation (scipy), and by linear regression (numpy) of log10 counts for both genes.
Generation of Tg(2.2eef1a1l1:h2b-mCherry2)
Using primers indicated below, a 2.2-kb genomic fragment upstream of the predicted eef1a1l1 translation start site was amplified from purified zebrafish AB strain genomic DNA using Phusion polymerase. PCR cycling conditions: 98°C for 1 min; 35 cycles of 98°C for 10 s and 72°C for 3 min; followed by 72°C for 5 min. The resulting amplicon was ligated into a pMTB vector backbone containing superfolder GFP (Addgene #112225) to replace the pMTB actb2 promoter with that of eef1a1l1, yielding Tg(2.2eef1a1l1:sfGFP). The eef1a1l1 promoter was subsequently subcloned to generate Tg(2.2eef1a1l1:h2b-mCherry2) via a 3-fragment NEB HiFi DNA assembly. The cloned 2.2-kb regulatory fragment contained an approximately 800-bp deletion within the upstream region relative to the corresponding AB and TU reference genome sequences. The complete experimentally tested sequence is available via Addgene #254876. Tg(2.2eef1a1l1:h2b-mCherry2) was used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with Tol2 mRNA (50 ng/µL) (Kawakami and Shima 1999) and plasmid DNA (10 ng/µL). Transgenic founders were identified by live fluorescence imaging. Primer sequences used for cloning the 2.2-kb fragment upstream of eef1a1l1 (NM_131263) are F: GGCCAAAGGTTTGACAACAT, R: GATTGATAAGTTTCTGCGGAC.
Generation of pIGLET Transgenics
To extend the eef1a1l1 promoter from 2.2 to 2.6 kb, additional sequence predicted from the ZFIN GRCz11 annotation (chr19 43119713-43120103) was synthesized (Twist Biosciences) and subcloned into the 2.2-kb driver plasmid. Because this region included the first exon, a potential translation initiation codon (ATG) was changed to AGG to prevent expression of a truncated eef1a1l1 product. To generate plasmids MGCO-04 (2.2-kb version) and MGCO-27 (2.6-kb version) for mStayGold:sec61b constructs, we synthesized an iCodon-optimized (Diez et al. 2022) (https://bazzinilab.shinyapps.io/icodon/) version of sec61b based on the Sec61 amino acid sequence from the Davidson collection plasmid pmApple-Sec61-C-18 (Tsuda et al. 2023) with overhangs for NEBuilder HiFi DNA assembly cloning (NEB). First, we added the mStayGold c4 linker (Hirano et al. 2022) to a base plasmid (pDQM102) with a 2.2-kb eef1a1l1:mStayGold insert using a KLD mutagenesis reaction with primers, C4-KLD-F AGCGCGAGTGCTGTAGGAGCCTCCGGAGCCTCCG, and C4-KLD-R AGGTTCATGCCAGGGCAAGTGAGCCTCCAGGGTTTCG. Next, to generate plasmid MGCO-04 we performed an NEBuilder HiFi DNA assembly reaction with PCR-amplified backbone using primers, 3p-linker-DQM-SV40-F taaatcgatgatgatccagacatgataag and 3p-linker-DQM-R TGGCGCGCCGGAGGCTC and the synthesized sec61b block. To add the additional eef1a1l1 promoter sequence to generate MGCO-27, we amplified the backbone of MGCO-04 using primers pDQM-ef1a-extraF tttgttaatcAGgccgccacCATGGGAGCATCGGG and pDQM-ef1a-extra-R ccgtaatgactaggccctcgag and primers pDQM133-ef1a-exonF cggctcgagggcctagtcattac and pDQM133-ef1a-exon-R CCATGgtggcggcCTgattaa. Plasmid sequence was verified by whole plasmid sequencing. Plasmids MGCO-04 and MGCO-27 were used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with PhiC31 mRNA (25 ng/ul) and plasmid DNA (25 ng/ul). Transgenic founders were identified by PCR screening of sperm followed up by live fluorescence imaging. Genotyping to confirm integration was performed using the following primers: DM323, CCTAGCGCGAGTGCTGT and DM320, CTGACTGCGTCACTTTGACAC for insertion at the pIGLET14a locus and DM235 acaccgtcttactctaaagaaacacg and DM387 CCATATCTCCAGTCAGAACAG to confirm the amplicon difference between the 2.2-kb and 2.6-kb promoter.
Confocal Microscopy and Image Quantification
Imaging data for the Tol2-based Tg(2.2eef1a1l1:h2b-mCherry2) (Fig. 1E) were collected on a Leica Stellaris 5 scanning confocal microscope. Shown is a tiled maximum intensity projection collected using an HC PL APO L 10x/0.40 CS2 objective (Leica). Imaging data for the phiC31-based pIGLET alleles Tg(p14a.2.2eef1a1l1:mSG-sec61b) and Tg(p14a.2.6eef1a1l1:mSG-sec61b) (Fig. 1H) were collected from heterozygous outcrossed casper embryos reared at 28˚C to 72hpf. Larvae were anesthetized in tricaine and mounted in a glass bottom 96-well dish (Ibidi 89626). Imaging was performed with a Yokogawa X Spinning Disk confocal microscope on a Nikon TiE frame using a Hamamatsu EM-CCD camera. Single channel z-stacks of the trunk/flank musculature just posterior to the yolk extension were acquired with the 488nm laser (100% power, 150 ms). Z-stacks comprised a 60 µm volume sampled every 5 µm, or 13 planes per z-stack. Acquisition settings were identical for all data collection. A single field of view was captured per animal. Background reference acquisitions were collected using identical settings, to capture camera offset and read noise (laser off) and laser-induced background on an empty field of view (laser on). Representative maximum intensity projections are shown in Figure 1H.
Image Quantification and Statistical Analyses
Image analysis was performed in Python 3.12.2 (numpy 2.4.2, scipy 1.17.1, pandas 3.0.0, scikit-image 0.26.0, matplotlib 3.10.9, nd2 0.11.3) using scripts co-authored with Claude Opus 4.8 (Anthropic). A per-pixel total background (mean of the laser-on reference frames) was subtracted and the result clipped at zero for each z-stack. For each z-stack we quantified the mean-over-stack: the mean of all voxels of the background-subtracted stack. This metric is linear (proportional to total signal divided by the number of z-planes), independent of projection choice, and insensitive to the number of optical sections, avoiding the non-linearity and z-plane-count sensitivity of max-intensity-projection means. Per-fish mean-over-stack values were compared between the 2.2 kb (n = 17) and 2.6 kb (n = 30) promoter constructs using a two-sided Mann–Whitney U test (primary), with a Welch *t*-test and Cohen's *d* effect size reported alongside. The two promoter lengths were statistically indistinguishable (482 ± 49 vs 464 ± 37 A.U., mean ± s.d.; Mann–Whitney p = 0.26; Welch *t*-test p = 0.15; Cohen's *d* = −0.43; fold change 0.96X). All analysis code, per-fish measurement tables, and figures are available at https://github.com/dqmatus/piglet14a-sec61b-staygold. The reported statistics and quantification plot can be regenerated from the committed measurement tables with `scripts/reproduce_stats.py` (no raw data required). Raw confocal z-stacks are archived on Zenodo (https://doi.org/10.5281/zenodo.21520506) and support full reproduction including the representative image panels.
","reagents":"Zebrafish lines and corresponding ZFIN allele designations and Addgene plasmid accessions described in this study are as follows: casper: mitfa^w2/w2; mpv17^a9/a9; Tg(2.2eef1a1l1:h2b-mCherry2)s5002Tg (Addgene #254876); Tg(2.2eef1a1l1:h2b-mNeonGreen)s5001Tg (Addgene #254877); Tg(p14a.2.2eef1a1l1:mSG-sec61b)bbc459Tg; and Tg(p14a.2.6eef1a1l1:mSG-sec61b)bbc460Tg (Addgene #258401). Transgenic zebrafish lines s5001Tg, s5002Tg, bbc459Tg, and bbc460Tg are available upon request.
","patternDescription":"Housekeeping genes are widely used as reference controls for gene expression analyses and as transgenic drivers. Across model systems, a relatively small number of such genes have become established for this purpose, owing to broad expression and relative stability across life stages and biological contexts. In zebrafish, commonly used references include ubiquitin B (ubb), beta-actin (actb1; actb2), and glyceraldehyde-3-phosphate dehydrogenase (gapdh) (Burket et al. 2008; Mosimann et al. 2011; Choe et al. 2021). Translation elongation factor 1-alpha 1-like 1 (eef1a1l1) has been repeatedly evaluated against other reference genes and ranks among the most stable across developmental stages and tissues (Tang et al. 2007); sex, tissues, stages, and perturbations (McCurley and Callard 2008; Xu et al. 2016); and across organs in transgenic and wild-type backgrounds (Rassier et al. 2020). Absolute transcript numbers in early embryonic stages have also been reported (Ligunas and Materna 2026). Much of this supporting evidence, however, derives from bulk profiling measurements that cannot resolve whether expression stability is preserved within or between cell types. Whole-embryo single-cell RNA sequencing (scRNA-seq) provides an opportunity to evaluate housekeeping genes using empirical measures of expression abundance and stability across individual cells. Here, we interrogated ZMAP (Aponte-Santiago et al. 2026), a zebrafish scRNA-seq meta-atlas comprising 798,790 cells from eight published datasets (Farrell et al. 2018; Spanjaard et al. 2018; Wagner et al. 2018; Farnsworth et al. 2020; Kamimoto et al. 2023; Sur et al. 2023; Kukreja et al. 2024; Lange et al. 2024) to systematically evaluate gene expression abundance and stability across cell types, developmental stages, and technologies.
To assess housekeeping-like characteristics in an unbiased manner, we compared normalized dispersion and global mean expression across all 36,365 genes in ZMAP (Extended Data Table 1). A total of 30 genes satisfied criteria for both stability (normalized dispersion < 0) and high mean expression across cells (top 0.1%) (Fig. 1A). Among these 30 genes, the majority (27/30) encoded ribosomal proteins. eef1a1l1 ranked as the top non-ribosomal gene meeting both criteria, while other references ubb, actb2, and gapdh satisfied at most one of these criteria. We next confirmed broad, stable eef1a1l1 expression across the ZMAP developmental manifold (Fig. 1B). Across ZMAP cell types stratified by developmental stage and originating study, eef1a1l1 showed high mean expression and was detected in a large fraction of cells (Fig. 1C).
EF1a regulatory elements are widely used as constitutive transgenic drivers across model systems, yet zebrafish eef1a1l1-based reagents remain less extensively developed. Some studies have utilized a Xenopus Ef1a-derived 500-bp driver that was later found to be prone to silencing (Johnson and Krieg 1994; Kawakami et al. 2004; Thummel et al. 2006; Burket et al. 2008). A subsequent line based on 1.4 kb of zebrafish eef1a1l1 upstream sequence drove broad expression, but has not been widely adopted (Moon et al. 2013). Motivated by this gap, we set out to develop additional transgenic reagents based on this locus. We evaluated two candidate transgenic drivers: (1) a 2.2-kb genomic sequence upstream of the endogenous eef1a1l1 start codon, encompassing the promoter, 5′ UTR, and first intron; and (2) a 2.6-kb sequence comprising the same upstream regions and extending into the second intron to encompass a broad H3K4me3 peak (Fig. 1D) (Baranasic et al. 2022).
We first tested the ability of the 2.2-kb construct to drive expression in live embryos using Tol2 transgenics. Live confocal imaging of Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 24 hours post-fertilization (hpf) revealed reporter signals that spanned multiple tissues and anatomical regions (Fig. 1E), demonstrating broad expression activity. To evaluate the 2.2-kb driver at single-cell resolution, we used zmap-tools to annotate an external inDrops scRNA-seq dataset collected from Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 29 hpf (see Methods). Projection onto the ZMAP reference enabled annotation of 8,587 transgenic cells across 46 cell types, each mapping to discrete regions of the UMAP embedding (Fig. 1F). Because raw housekeeping gene counts vary with RNA content, cell size, and transcript capture, we asked whether raw pseudobulked mCherry2 counts scaled with those of endogenous eef1a1l1 across cell types. This analysis revealed a strong positive relationship that was approximately linear in log-transformed counts (Spearman’s ρ=0.77, P=5.4e-10; slope=1.3, R2=0.65) and was stronger than correlations between mCherry2 and actb2, gapdh, or ubb (Fig. 1G). These data demonstrate that reporter transcript abundance driven by the 2.2-kb sequence broadly covaries with that of endogenous eef1a1l1 across diverse embryonic cell types.
We next compared the performance of the 2.2-kb and 2.6-kb drivers using the standardized safe-harbor locus: phiC31 Integrase Genomic Loci Engineered for Transgenesis 14a (“pIGLET14a”) (Lalonde et al. 2024), and an ER-localized monomeric StayGold fluorescent reporter (Diez et al. 2022; Tschanz et al. 2025). Live imaging of heterozygous Tg(p14a.2.2eef1a1l1:mSG-sec61b) or Tg(p14a.2.6eef1a1l1:mSG-sec61b) carriers at 72 hpf revealed broad reporter expression across tissues in both lines (Fig. 1H), with no significant difference in mean fluorescence intensity across confocal z-stacks (Fig. 1I). Thus, at the pIGLET14a locus, both drivers displayed similar performance with respect to overall expression level and tissue distribution.
While both the 2.2-kb and 2.6-kb sequences appear capable of driving broad transgene expression, we recommend the 2.6-kb sequence for future work as it retains a larger portion of the endogenous promoter-associated region. For Tol2-based transgenics, we recommend the evaluation of multiple independent founders to account for integration and founder-specific effects; alternatively, this construct performs well with pIGLET-targeted integration. To support community usage, plasmids generated in this study are available through Addgene, and stable transgenic lines are available by direct request. Together, these findings support the use of eef1a1l1 as a stable endogenous reference for zebrafish embryonic gene expression and further demonstrate the use of its upstream regulatory sequence as a practical and broad transgene driver.
","references":[{"reference":"Aponte Santiago NA, Su Y, Wagner DE. 2026. ZMAP: A single-cell meta-atlas of zebrafish embryonic development reveals. bioRxiv","pubmedId":"","doi":"10.64898/2026.03.23.713599"},{"reference":"Baranasic D, Hortenhuber M, Balwierz PJ, Zehnder T, Mukarram AK, Nepal C, et al., Muller F. 2022. Multiomic atlas with functional stratification and developmental dynamics. Nat. Genet. 54: 1037-1050.","pubmedId":"","doi":"10.1038/s41588-022-01089-w"},{"reference":"Burket CT, Montgomery JE, Thummel R, Kassen SC, La Fave MC, Langenau DM, Zon LI, Hyde DR. 2008. Generation and characterization of transgenic zebrafish lines using. Transgenic Res. 17: 265-279.","pubmedId":"","doi":"10.1007/s11248-007-9152-5"},{"reference":"Choe CP, Choi SY, Kee Y, Kim MJ, Kim SH, Lee Y, Park HC, Ro H. 2021. Transgenic fluorescent zebrafish lines that have revolutionized biomedical. Lab. Anim. Res. 37: 26.","pubmedId":"","doi":"10.1186/s42826-021-00103-2"},{"reference":"Diez M, Medina Munoz SG, Castellano LA, Da Silva Pescador G, Wu Q, Bazzini AA. 2022. iCodon customizes gene expression based on the codon composition. Sci. Rep. 12: 12126.","pubmedId":"","doi":"10.1038/s41598-022-15526-7"},{"reference":"Farnsworth DR, Saunders LM, Miller AC. 2020. A single-cell transcriptome atlas for zebrafish development. Dev. Biol. 459: 100-108.","pubmedId":"","doi":"10.1016/j.ydbio.2019.11.008"},{"reference":"Farrell JA, Wang Y, Riesenfeld SJ, Shekhar K, Regev A, Schier AF. 2018. Single-cell reconstruction of developmental trajectories during zebrafish. Science. 360","pubmedId":"","doi":"10.1126/science.aar3131"},{"reference":"Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, et al., Miyawaki A. 2022. A highly photostable and bright green fluorescent protein. Nat. Biotechnol. 40: 1132-1142.","pubmedId":"","doi":"10.1038/s41587-022-01278-2"},{"reference":"Johnson AD, Krieg PA. 1994. pXeX, a vector for efficient expression of cloned sequences in Xenopus. Gene. 147: 223-226.","pubmedId":"","doi":"10.1016/0378-1119(94)90070-1"},{"reference":"Kamimoto K, Stringa B, Hoffmann CM, Jindal K, Solnica Krezel L, Morris SA. 2023. Dissecting cell identity via network inference and in silico gene. Nature. 614: 742-751.","pubmedId":"","doi":"10.1038/s41586-022-05688-9"},{"reference":"Kawakami K, Shima A. 1999. Identification of the Tol2 transposase of the medaka fish Oryzias latipes. Gene. 240: 239-244.","pubmedId":"","doi":"10.1016/s0378-1119(99)00444-8"},{"reference":"Kawakami K, Takeda H, Kawakami N, Kobayashi M, Matsuda N, Mishina M. 2004. A transposon-mediated gene trap approach identifies developmentally. Dev. Cell. 7: 133-144.","pubmedId":"","doi":"10.1016/j.devcel.2004.06.005"},{"reference":"Kukreja K, Jia BZ, Mc Geary SE, Patel N, Megason SG, Klein AM. 2024. Cell state transitions are decoupled from cell division during early. Nat. Cell Biol. 26: 2035-2045.","pubmedId":"","doi":"10.1038/s41556-024-01546-0"},{"reference":"Lalonde RL, Wells HH, Kemmler CL, Nieuwenhuize S, Lerma R, Burger A, Mosimann C. 2024. pIGLET: Safe harbor landing sites for reproducible and efficient. Sci. Adv. 10: eadn6603.","pubmedId":"","doi":"10.1126/sciadv.adn6603"},{"reference":"Lange M, Granados A, Vijay Kumar S, Bragantini J, Ancheta S, Kim YJ, et al., Royer LA. 2024. A multimodal zebrafish developmental atlas reveals the state-transition. Cell. 187: 6742-6759.e17.","pubmedId":"","doi":"10.1016/j.cell.2024.09.047"},{"reference":"Ligunas GD, Materna SC. 2026. Quantification of eef1a1l1 transcript in early zebrafish development. MicroPubl. Biol. 2026","pubmedId":"","doi":"10.17912/micropub.biology.001944"},{"reference":"Mc Curley AT, Callard GV. 2008. Characterization of housekeeping genes in zebrafish: male-female. BMC Mol. Biol. 9: 102.","pubmedId":"","doi":"10.1186/1471-2199-9-102"},{"reference":"Moon HY, Kim OH, Kim HT, Choi JH, Yeo SY, Kim NS, et al., Kim CH. 2013. Establishment of a transgenic zebrafish EF1α:Kaede for monitoring cell. Fish Shellfish Immunol. 34: 1390-1394.","pubmedId":"","doi":"10.1016/j.fsi.2013.02.021"},{"reference":"Mosimann C, Kaufman CK, Li P, Pugach EK, Tamplin OJ, Zon LI. 2011. Ubiquitous transgene expression and Cre-based recombination driven by the. Development. 138: 169-177.","pubmedId":"","doi":"10.1242/dev.059345"},{"reference":"Rassier GT, Silveira TLR, Remiao MH, Daneluz LO, Martins AWS, Dellagostin EN, et al., Campos VF. 2020. Evaluation of qPCR reference genes in GH-overexpressing transgenic. Sci. Rep. 10: 12692.","pubmedId":"","doi":"10.1038/s41598-020-69423-y"},{"reference":"Spanjaard B, Hu B, Mitic N, Olivares Chauvet P, Janjuha S, Ninov N, Junker JP. 2018. Simultaneous lineage tracing and cell-type identification using. Nat. Biotechnol. 36: 469-473.","pubmedId":"","doi":"10.1038/nbt.4124"},{"reference":"Sur A, Wang Y, Capar P, Margolin G, Prochaska MK, Farrell JA. 2023. Single-cell analysis of shared signatures and transcriptional diversity. Dev. Cell. 58: 3028-3047.e12.","pubmedId":"","doi":"10.1016/j.devcel.2023.11.001"},{"reference":"Tang R, Dodd A, Lai D, Mc Nabb WC, Love DR. 2007. Validation of zebrafish (Danio rerio) reference genes for quantitative. Acta Biochim. Biophys. Sin. (Shanghai). 39: 384-390.","pubmedId":"","doi":"10.1111/j.1745-7270.2007.00283.x"},{"reference":"Thummel R, Burket CT, Hyde DR. 2006. Two different transgenes to study gene silencing and re-expression during. ScientificWorldJournal. 6 Suppl 1: 65-81.","pubmedId":"","doi":"10.1100/tsw.2006.328"},{"reference":"Tschanz A, Matus DQ, Swinburne I. 2025. Systematic comparison of mStayGold and mGold2 variants for live imaging in. MicroPubl. Biol. 2025","pubmedId":"","doi":"10.17912/micropub.biology.001847"},{"reference":"Tsuda N, Fukagawa R, Sueda S. 2023. Does the nuclear envelope retain its identity during mitosis?. FEBS Lett. 597: 682-692.","pubmedId":"","doi":"10.1002/1873-3468.14568"},{"reference":"Wagner DE, Weinreb C, Collins ZM, Briggs JA, Megason SG, Klein AM. 2018. Single-cell mapping of gene expression landscapes and lineage in the. Science. 360: 981-987.","pubmedId":"","doi":"10.1126/science.aar4362"},{"reference":"Xu H, Li C, Zeng Q, Agrawal I, Zhu X, Gong Z. 2016. Genome-wide identification of suitable zebrafish Danio rerio reference. J. Fish Biol. 88: 2095-2110.","pubmedId":"","doi":"10.1111/jfb.12915"}],"title":"Evaluation of eef1a1l1 expression stability and promoter-driven reporter activity during zebrafish development
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":"1788962893401"}]},{"id":"b1fb5ae3-31a7-4baa-ba00-7e95bdc8cce3","decision":"publish","abstract":"Housekeeping genes are widely used as experimental references for gene expression, yet many exhibit substantial variation within and between cell types. Using Zebrafish Meta Atlas Project (ZMAP), we found eef1a1l1 to be ubiquitously and highly expressed across zebrafish embryonic cell types, developmental stages, and studies. Transgenic reporters driven by 2.2-kb or 2.6-kb eef1a1l1-derived regulatory sequences showed broad embryonic expression, and single-cell profiling revealed that reporter abundance covaried with that of the endogenous eef1a1l1 transcript. These findings further support eef1a1l1 as a reference for embryonic gene expression and the use of its regulatory sequence as a practical, multipurpose transgenic driver.
","acknowledgements":"The authors thank Sean Megason and the Wagner Lab at UCSF for feedback and discussions and Velat Kilic at UC Berkeley for code review. Additionally, we thank Kelsey Voge and Krista Zimmerman at Janelia Research Campus for help with zebrafish injections, screening and sperm genotyping of potential founders.
","authors":[{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["writing_reviewEditing","investigation"],"email":"Nicole.AponteSantiago@ucsf.edu","firstName":"Nicole A. ","lastName":"Aponte-Santiago","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["methodology","investigation","writing_reviewEditing"],"email":"Nicole.Suren@ucsf.edu","firstName":"Nicole","lastName":"Suren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["formalAnalysis"],"email":"Yingxin.Su@ucsf.edu","firstName":"Yingxin","lastName":"Su","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation"],"email":"coralh@berkeley.edu","firstName":"Coral N. ","lastName":"Halanych","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation"],"email":"matubrew@smith.edu","firstName":"Maile N.","lastName":"Matubrew","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Janelia Research Campus, Ashburn, VA, United States"],"departments":[""],"credit":["investigation"],"email":"songe@janelia.hhmi.org","firstName":"Erin ","lastName":"Song","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["methodology","supervision","writing_reviewEditing"],"email":"swinburne@berkeley.edu","firstName":"Ian A. ","lastName":"Swinburne","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC Berkeley, Berkeley, CA, United States"],"departments":["Department of Molecular and Cell Biology"],"credit":["investigation","methodology","writing_reviewEditing"],"email":"dqmatus@berkeley.edu","firstName":"David Q. ","lastName":"Matus","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Francisco, San Francisco, CA, United States","UC San Francisco, San Francisco, CA, United States"],"departments":["Department of Obstetrics, Gynecology and Reproductive Science, Center for Reproductive Sciences","Eli and Edythe Broad Center for Regeneration Medicine and Stem Cell Research"],"credit":["conceptualization","writing_originalDraft","writing_reviewEditing","supervision","investigation","methodology","fundingAcquisition"],"email":"Daniel.Wagner@ucsf.edu","firstName":"Daniel E. ","lastName":"Wagner","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2983-635X"}],"awards":[{"awardId":"","funderName":"CZ Biohub SF (United States)","awardRecipient":"Daniel E. Wagner"},{"awardId":"DP2GM146258 ","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Daniel E. Wagner"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table 1. Top 200 candidate housekeeping genes
Genes were identified from ZMAP by filtering for normalized dispersion < 0 and ranked by mean log transformed TPM expression. Columns include expression rank, gene symbol, mean log-TPM, normalized dispersion, Ensembl gene ID, RefSeq mRNA accession, functional category (manually assigned), and full gene name. Data for the top 200 ranked candidate genes are reported. The top 30 genes (ranks 1–30) satisfied both the stability criterion and high expression abundance (top 0.1% of all transcripts).
","doi":"10.22002/dpprq-cjx91","resourceType":"Text","name":"Extended_Data_Table1.csv","url":"https://portal.micropublication.org/uploads/c7740bf41705c9de739e18b13160c304.csv"}],"funding":"This work was supported by DP2GM146258 and a Chan Zuckerberg Biohub Investigator award.
","image":{"url":"https://portal.micropublication.org/uploads/9edfc53e35f03c44cc66e52d63bdc5f3.png"},"imageCaption":"(A) Left, scatterplot of normalized dispersion versus log-transformed mean TPM (transcripts per million) expression counts for all genes in ZMAP. Genes are colored by classification criteria: stable (normalized dispersion values < 0, blue), abundant (top 0.1% of mean expression, red), and stable + abundant (satisfying both criteria, magenta). Labels for example housekeeping genes are shown. Right, top candidate housekeeping genes, jointly ranked by dispersion and abundance (see also Extended Data Table 1).
(B) UMAP overlay of eef1a1l1 transcript counts expressed as log-normalized TPM counts, showing high and broadly distributed expression across cells.
(C) Dot plot of eef1a1l1 expression across CellType groups, stratified by developmental time window (left) and contributing study (right). Dot color and size reflect average expression and fraction of expressing cells, respectively. Omitted groups with insufficient cell numbers (<10 cells or <1% of the group’s total representation in the integrated dataset) are depicted as gray circles.
(D) Construct design (not to scale). Transcription start site (TSS), ATG start codon, and genomic positions (GRCz11) are indicated.
(E) Representative confocal maximum-intensity projection of a live Tg(2.2eef1a1l1:h2b-mCherry2) embryo at 24 hours post-fertilization (hpf). Nuclear mCherry2 signal is observed across diverse tissues. Scale bar, 200 µm. Labels indicate major anatomical structures: fb (forebrain), mb (midbrain), mhb (midbrain-hindbrain boundary), hb (hindbrain), evl (enveloping layer), ot (otic vesicle), ret (retina), len (lens), hg (hatching gland), ysl (yolk syncytial layer), som (somites), tb (tailbud), and sc (spinal cord).
(F) Projection of an inDrops scRNA-seq dataset generated from Tg(2.2eef1a1l1:h2b-mCherry2) embryos onto the ZMAP reference using the zmap-tools annotation pipeline. A total of 8,587 cells were annotated. Assigned labels (n=46) are indicated and colored according to germ layer groupings.
(G) Pseudobulk mean raw counts per annotated cell type (n=46) for mCherry2 and eef1a1l1. Point size scales with log10 cell number per group; colors as in (F). Dashed line, linear regression fit. Inset: Spearman's rho (ρ), P-value, log-log slope and R2. Table: Spearman’s rho against eef1a1l1 for mCherry2 and indicated control genes.
(H) Representative spinning disk confocal maximum-intensity projections of live Tg(p14a.2.2eef1a1l1:mSG-sec61b) (left) and Tg(p14a.2.6eef1a1l1:mSG-sec61b) (right) embryos at 72 hpf of the trunk/flank musculature just posterior to the yolk extension. Scale bar, 100 µm.
(I) Quantification of n>17 projections per allele, n.s. not significant (p = 0.26, Mann–Whitney test).
","imageTitle":"Evaluation of eef1a1l1 as a broadly expressed housekeeping gene
","methods":"Analysis of scRNA-seq Data
Processed scRNA-seq data were obtained from the Zebrafish Meta Atlas Project (ZMAP) (Aponte-Santiago et al. 2026), which comprises PRJNA417290, PRJNA929041, PRJNA445487, PRJNA1123686, PRJNA564810, PRJNA940501, PRJNA321866, and PRJNA606682. Additional public inDrops scRNA-seq data were obtained from GSE326623 (PRJNA1446332). Analyses used zmap-tools [v0.2.2.2], scanpy [v1.12.1], scipy [v1.16.3], numpy [v2.0.2], and matplotlib [v3.10.0] in Python [v3.12.13]. Housekeeping gene statistics (normalized dispersion and normalized transcript abundance) were calculated using scanpy.pp.highly_variable_genes and plotted using matplotlib (Fig. 1A). The UMAP embedding and dotplot (Fig. 1B-C) were generated using scanpy.pl.embedding and zmap.dotplot.gene_view, using all cells in the ZMAP reference. zmap-tools was also used to pre-process, project, and annotate scRNA-seq data collected from Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 29 hpf using zmap.predict.annotate_with_zmap (Fig. 1F); annotation was performed at the “CellType” level of the ZMAP ontology and p_thresh was set to 0.5. For pseudobulk correlation analyses (Fig. 1G), cells were grouped by their predicted “CellType” and mean raw UMI counts per cell for each gene were calculated. Concordance between mCherry2 and eef1a1l1 across cell types was quantified by Spearman's rank correlation (scipy), and by linear regression (numpy) of log10 counts for both genes.
Generation of Tg(2.2eef1a1l1:h2b-mCherry2)
Using primers indicated below, a 2.2-kb genomic fragment upstream of the predicted eef1a1l1 translation start site was amplified from purified zebrafish AB strain genomic DNA using Phusion polymerase. PCR cycling conditions: 98°C for 1 min; 35 cycles of 98°C for 10 s and 72°C for 3 min; followed by 72°C for 5 min. The resulting amplicon was ligated into a pMTB vector backbone containing superfolder GFP (Addgene #112225) to replace the pMTB actb2 promoter with that of eef1a1l1, yielding Tg(2.2eef1a1l1:sfGFP). The eef1a1l1 promoter was subsequently subcloned to generate Tg(2.2eef1a1l1:h2b-mCherry2) via a 3-fragment NEB HiFi DNA assembly. The cloned 2.2-kb regulatory fragment contained an approximately 800-bp deletion within the upstream region relative to the corresponding AB and TU reference genome sequences. The complete experimentally tested sequence is available via Addgene #254876. Tg(2.2eef1a1l1:h2b-mCherry2) was used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with Tol2 mRNA (50 ng/µL) (Kawakami and Shima 1999) and plasmid DNA (10 ng/µL). Transgenic founders were identified by live fluorescence imaging. Primer sequences used for cloning the 2.2-kb fragment upstream of eef1a1l1 (NM_131263) are F: GGCCAAAGGTTTGACAACAT, R: GATTGATAAGTTTCTGCGGAC.
Generation of pIGLET Transgenics
To extend the eef1a1l1 promoter from 2.2 to 2.6 kb, additional sequence predicted from the ZFIN GRCz11 annotation (chr19 43119713-43120103) was synthesized (Twist Biosciences) and subcloned into the 2.2-kb driver plasmid. Because this region included the first exon, a potential translation initiation codon (ATG) was changed to AGG to prevent expression of a truncated eef1a1l1 product. To generate plasmids MGCO-04 (2.2-kb version) and MGCO-27 (2.6-kb version) for mStayGold:sec61b constructs, we synthesized an iCodon-optimized (Diez et al. 2022) (https://bazzinilab.shinyapps.io/icodon/) version of sec61b based on the Sec61 amino acid sequence from the Davidson collection plasmid pmApple-Sec61-C-18 (Tsuda et al. 2023) with overhangs for NEBuilder HiFi DNA assembly cloning (NEB). First, we added the mStayGold c4 linker (Hirano et al. 2022) to a base plasmid (pDQM102) with a 2.2-kb eef1a1l1:mStayGold insert using a KLD mutagenesis reaction with primers, C4-KLD-F AGCGCGAGTGCTGTAGGAGCCTCCGGAGCCTCCG, and C4-KLD-R AGGTTCATGCCAGGGCAAGTGAGCCTCCAGGGTTTCG. Next, to generate plasmid MGCO-04 we performed an NEBuilder HiFi DNA assembly reaction with PCR-amplified backbone using primers, 3p-linker-DQM-SV40-F taaatcgatgatgatccagacatgataag and 3p-linker-DQM-R TGGCGCGCCGGAGGCTC and the synthesized sec61b block. To add the additional eef1a1l1 promoter sequence to generate MGCO-27, we amplified the backbone of MGCO-04 using primers pDQM-ef1a-extraF tttgttaatcAGgccgccacCATGGGAGCATCGGG and pDQM-ef1a-extra-R ccgtaatgactaggccctcgag and primers pDQM133-ef1a-exonF cggctcgagggcctagtcattac and pDQM133-ef1a-exon-R CCATGgtggcggcCTgattaa. Plasmid sequence was verified by whole plasmid sequencing. Plasmids MGCO-04 and MGCO-27 were used for transgenesis by co-microinjection of single-cell stage zebrafish embryos with PhiC31 mRNA (25 ng/ul) and plasmid DNA (25 ng/ul). Transgenic founders were identified by PCR screening of sperm followed up by live fluorescence imaging. Genotyping to confirm integration was performed using the following primers: DM323, CCTAGCGCGAGTGCTGT and DM320, CTGACTGCGTCACTTTGACAC for insertion at the pIGLET14a locus and DM235 acaccgtcttactctaaagaaacacg and DM387 CCATATCTCCAGTCAGAACAG to confirm the amplicon difference between the 2.2-kb and 2.6-kb promoter.
Confocal Microscopy and Image Quantification
Imaging data for the Tol2-based Tg(2.2eef1a1l1:h2b-mCherry2) (Fig. 1E) were collected on a Leica Stellaris 5 scanning confocal microscope. Shown is a tiled maximum intensity projection collected using an HC-PL-APO-L 10x/0.40 CS2 objective (Leica). Imaging data for the phiC31-based pIGLET alleles Tg(p14a.2.2eef1a1l1:mSG-sec61b) and Tg(p14a.2.6eef1a1l1:mSG-sec61b) (Fig. 1H) were collected from heterozygous outcrossed casper embryos reared at 28˚C to 72hpf. Larvae were anesthetized in tricaine and mounted in a glass bottom 96-well dish (Ibidi 89626). Imaging was performed with a Yokogawa X Spinning Disk confocal microscope on a Nikon TiE frame using a Hamamatsu EM-CCD camera. Single channel z-stacks of the trunk/flank musculature just posterior to the yolk extension were acquired with the 488nm laser (100% power, 150 ms). Z-stacks comprised a 60 µm volume sampled every 5 µm, or 13 planes per z-stack. Acquisition settings were identical for all data collection. A single field of view was captured per animal. Background reference acquisitions were collected using identical settings, to capture camera offset and read noise (laser off) and laser-induced background on an empty field of view (laser on). Representative maximum intensity projections are shown in Figure 1H.
Image Quantification and Statistical Analyses
Image analysis was performed in Python 3.12.2 (numpy 2.4.2, scipy 1.17.1, pandas 3.0.0, scikit-image 0.26.0, matplotlib 3.10.9, nd2 0.11.3) using scripts co-authored with Claude Opus 4.8 (Anthropic). A per-pixel total background (mean of the laser-on reference frames) was subtracted and the result clipped at zero for each z-stack. For each z-stack we quantified the mean-over-stack: the mean of all voxels of the background-subtracted stack. This metric is linear (proportional to total signal divided by the number of z-planes), independent of projection choice, and insensitive to the number of optical sections, avoiding the non-linearity and z-plane-count sensitivity of max-intensity-projection means. Per-fish mean-over-stack values were compared between the 2.2 kb (n = 17) and 2.6 kb (n = 30) promoter constructs using a two-sided Mann–Whitney U test (primary), with a Welch *t*-test and Cohen's *d* effect size reported alongside. The two promoter lengths were statistically indistinguishable (482 ± 49 vs 464 ± 37 A.U., mean ± s.d.; Mann–Whitney p = 0.26; Welch *t*-test p = 0.15; Cohen's *d* = −0.43; fold change 0.96X). All analysis code, per-fish measurement tables, and figures are available at https://github.com/dqmatus/piglet14a-sec61b-staygold. The reported statistics and quantification plot can be regenerated from the committed measurement tables with `scripts/reproduce_stats.py` (no raw data required). Raw confocal z-stacks are archived on Zenodo (https://doi.org/10.5281/zenodo.21520506) and support full reproduction including the representative image panels.
","reagents":"Zebrafish lines and corresponding ZFIN allele designations and Addgene plasmid accessions described in this study are as follows: casper: mitfa^w2/w2; mpv17^a9/a9; Tg(2.2eef1a1l1:h2b-mCherry2)s5002Tg (Addgene #254876); Tg(2.2eef1a1l1:h2b-mNeonGreen)s5001Tg (Addgene #254877); Tg(p14a.2.2eef1a1l1:mSG-sec61b)bbc459Tg; and Tg(p14a.2.6eef1a1l1:mSG-sec61b)bbc460Tg (Addgene #258401). Transgenic zebrafish lines s5001Tg, s5002Tg, bbc459Tg, and bbc460Tg are available upon request.
","patternDescription":"Housekeeping genes are widely used as reference controls for gene expression analyses and as transgenic drivers. Across model systems, a relatively small number of such genes have become established for this purpose, owing to broad expression and relative stability across life stages and biological contexts. In zebrafish, commonly used references include ubiquitin B (ubb), beta-actin (actb1; actb2), and glyceraldehyde-3-phosphate dehydrogenase (gapdh) (Burket et al. 2008; Mosimann et al. 2011; Choe et al. 2021). Translation elongation factor 1-alpha 1-like 1 (eef1a1l1) has been repeatedly evaluated against other reference genes and ranks among the most stable across developmental stages and tissues (Tang et al. 2007); sex, tissues, stages, and perturbations (McCurley and Callard 2008; Xu et al. 2016); and across organs in transgenic and wild-type backgrounds (Rassier et al. 2020). Absolute transcript numbers in early embryonic stages have also been reported (Ligunas and Materna 2026). Much of this supporting evidence, however, derives from bulk profiling measurements that cannot resolve whether expression stability is preserved within or between cell types. Whole-embryo single-cell RNA sequencing (scRNA-seq) provides an opportunity to evaluate housekeeping genes using empirical measures of expression abundance and stability across individual cells. Here, we interrogated ZMAP (Aponte-Santiago et al. 2026), a zebrafish scRNA-seq meta-atlas comprising 798,790 cells from eight published datasets (Farrell et al. 2018; Spanjaard et al. 2018; Wagner et al. 2018; Farnsworth et al. 2020; Kamimoto et al. 2023; Sur et al. 2023; Kukreja et al. 2024; Lange et al. 2024) to systematically evaluate gene expression abundance and stability across cell types, developmental stages, and technologies.
To assess housekeeping-like characteristics in an unbiased manner, we compared normalized dispersion and global mean expression across all 36,365 genes in ZMAP (Extended Data Table 1). A total of 30 genes satisfied criteria for both stability (normalized dispersion < 0) and high mean expression across cells (top 0.1%) (Fig. 1A). Among these 30 genes, the majority (27/30) encoded ribosomal proteins. eef1a1l1 ranked as the top non-ribosomal gene meeting both criteria, while other references ubb, actb2, and gapdh satisfied at most one of these criteria. We next confirmed broad, stable eef1a1l1 expression across the ZMAP developmental manifold (Fig. 1B). Across ZMAP cell types stratified by developmental stage and originating study, eef1a1l1 showed high mean expression and was detected in a large fraction of cells (Fig. 1C).
EF1a regulatory elements are widely used as constitutive transgenic drivers across model systems, yet zebrafish eef1a1l1-based reagents remain less extensively developed. Some studies have utilized a Xenopus Ef1a-derived 500-bp driver that was later found to be prone to silencing (Johnson and Krieg 1994; Kawakami et al. 2004; Thummel et al. 2006; Burket et al. 2008). A subsequent line based on 1.4 kb of zebrafish eef1a1l1 upstream sequence drove broad expression, but has not been widely adopted (Moon et al. 2013). Motivated by this gap, we set out to develop additional transgenic reagents based on this locus. We evaluated two candidate transgenic drivers: (1) a 2.2-kb genomic sequence upstream of the endogenous eef1a1l1 start codon, encompassing the promoter, 5′ UTR, and first intron; and (2) a 2.6-kb sequence comprising the same upstream regions and extending into the second intron to encompass a broad H3K4me3 peak (Fig. 1D) (Baranasic et al. 2022).
We first tested the ability of the 2.2-kb construct to drive expression in live embryos using Tol2 transgenics. Live confocal imaging of Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 24 hours post-fertilization (hpf) revealed reporter signals that spanned multiple tissues and anatomical regions (Fig. 1E), demonstrating broad expression activity. To evaluate the 2.2-kb driver at single-cell resolution, we used zmap-tools to annotate an external inDrops scRNA-seq dataset collected from Tg(2.2eef1a1l1:h2b-mCherry2) embryos at 29 hpf (see Methods). Projection onto the ZMAP reference enabled annotation of 8,587 transgenic cells across 46 cell types, each mapping to discrete regions of the UMAP embedding (Fig. 1F). Because raw housekeeping gene counts vary with RNA content, cell size, and transcript capture, we asked whether raw pseudobulked mCherry2 counts scaled with those of endogenous eef1a1l1 across cell types. This analysis revealed a strong positive relationship that was approximately linear in log-transformed counts (Spearman’s ρ=0.77, P=5.4e-10; slope=1.3, R2=0.65) and was stronger than correlations between mCherry2 and actb2, gapdh, or ubb (Fig. 1G). These data demonstrate that reporter transcript abundance driven by the 2.2-kb sequence broadly covaries with that of endogenous eef1a1l1 across diverse embryonic cell types.
We next compared the performance of the 2.2-kb and 2.6-kb drivers using the standardized safe-harbor locus: phiC31 Integrase Genomic Loci Engineered for Transgenesis 14a (“pIGLET14a”) (Lalonde et al. 2024), and an ER-localized monomeric StayGold fluorescent reporter (Diez et al. 2022; Tschanz et al. 2025). Live imaging of heterozygous Tg(p14a.2.2eef1a1l1:mSG-sec61b) or Tg(p14a.2.6eef1a1l1:mSG-sec61b) carriers at 72 hpf revealed broad reporter expression across tissues in both lines (Fig. 1H), with no significant difference in mean fluorescence intensity across confocal z-stacks (Fig. 1I). Thus, at the pIGLET14a locus, both drivers displayed similar performance with respect to overall expression level and tissue distribution.
While both the 2.2-kb and 2.6-kb sequences appear capable of driving broad transgene expression, we recommend the 2.6-kb sequence for future work as it retains a larger portion of the endogenous promoter-associated region. For Tol2-based transgenics, we recommend the evaluation of multiple independent founders to account for integration and founder-specific effects; alternatively, this construct performs well with pIGLET-targeted integration. To support community usage, plasmids generated in this study are available through Addgene, and stable transgenic lines are available by direct request. Together, these findings support the use of eef1a1l1 as a stable endogenous reference for zebrafish embryonic gene expression and further demonstrate the use of its upstream regulatory sequence as a practical and broad transgene driver.
","references":[{"reference":"Aponte Santiago NA, Su Y, Wagner DE. 2026. ZMAP: A single-cell meta-atlas of zebrafish embryonic development reveals. bioRxiv","pubmedId":"","doi":"10.64898/2026.03.23.713599"},{"reference":"Baranasic D, Hortenhuber M, Balwierz PJ, Zehnder T, Mukarram AK, Nepal C, et al., Muller F. 2022. Multiomic atlas with functional stratification and developmental dynamics. Nat. Genet. 54: 1037-1050.","pubmedId":"","doi":"10.1038/s41588-022-01089-w"},{"reference":"Burket CT, Montgomery JE, Thummel R, Kassen SC, La Fave MC, Langenau DM, Zon LI, Hyde DR. 2008. Generation and characterization of transgenic zebrafish lines using. Transgenic Res. 17: 265-279.","pubmedId":"","doi":"10.1007/s11248-007-9152-5"},{"reference":"Choe CP, Choi SY, Kee Y, Kim MJ, Kim SH, Lee Y, Park HC, Ro H. 2021. Transgenic fluorescent zebrafish lines that have revolutionized biomedical. Lab. Anim. Res. 37: 26.","pubmedId":"","doi":"10.1186/s42826-021-00103-2"},{"reference":"Diez M, Medina Munoz SG, Castellano LA, Da Silva Pescador G, Wu Q, Bazzini AA. 2022. iCodon customizes gene expression based on the codon composition. Sci. Rep. 12: 12126.","pubmedId":"","doi":"10.1038/s41598-022-15526-7"},{"reference":"Farnsworth DR, Saunders LM, Miller AC. 2020. A single-cell transcriptome atlas for zebrafish development. Dev. Biol. 459: 100-108.","pubmedId":"","doi":"10.1016/j.ydbio.2019.11.008"},{"reference":"Farrell JA, Wang Y, Riesenfeld SJ, Shekhar K, Regev A, Schier AF. 2018. Single-cell reconstruction of developmental trajectories during zebrafish. Science. 360","pubmedId":"","doi":"10.1126/science.aar3131"},{"reference":"Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, et al., Miyawaki A. 2022. A highly photostable and bright green fluorescent protein. Nat. Biotechnol. 40: 1132-1142.","pubmedId":"","doi":"10.1038/s41587-022-01278-2"},{"reference":"Johnson AD, Krieg PA. 1994. pXeX, a vector for efficient expression of cloned sequences in Xenopus. Gene. 147: 223-226.","pubmedId":"","doi":"10.1016/0378-1119(94)90070-1"},{"reference":"Kamimoto K, Stringa B, Hoffmann CM, Jindal K, Solnica Krezel L, Morris SA. 2023. Dissecting cell identity via network inference and in silico gene. Nature. 614: 742-751.","pubmedId":"","doi":"10.1038/s41586-022-05688-9"},{"reference":"Kawakami K, Shima A. 1999. Identification of the Tol2 transposase of the medaka fish Oryzias latipes. Gene. 240: 239-244.","pubmedId":"","doi":"10.1016/s0378-1119(99)00444-8"},{"reference":"Kawakami K, Takeda H, Kawakami N, Kobayashi M, Matsuda N, Mishina M. 2004. A transposon-mediated gene trap approach identifies developmentally. Dev. Cell. 7: 133-144.","pubmedId":"","doi":"10.1016/j.devcel.2004.06.005"},{"reference":"Kukreja K, Jia BZ, Mc Geary SE, Patel N, Megason SG, Klein AM. 2024. Cell state transitions are decoupled from cell division during early. Nat. Cell Biol. 26: 2035-2045.","pubmedId":"","doi":"10.1038/s41556-024-01546-0"},{"reference":"Lalonde RL, Wells HH, Kemmler CL, Nieuwenhuize S, Lerma R, Burger A, Mosimann C. 2024. pIGLET: Safe harbor landing sites for reproducible and efficient. Sci. Adv. 10: eadn6603.","pubmedId":"","doi":"10.1126/sciadv.adn6603"},{"reference":"Lange M, Granados A, Vijay Kumar S, Bragantini J, Ancheta S, Kim YJ, et al., Royer LA. 2024. A multimodal zebrafish developmental atlas reveals the state-transition. Cell. 187: 6742-6759.e17.","pubmedId":"","doi":"10.1016/j.cell.2024.09.047"},{"reference":"Ligunas GD, Materna SC. 2026. Quantification of eef1a1l1 transcript in early zebrafish development. MicroPubl. Biol. 2026","pubmedId":"","doi":"10.17912/micropub.biology.001944"},{"reference":"Mc Curley AT, Callard GV. 2008. Characterization of housekeeping genes in zebrafish: male-female. BMC Mol. Biol. 9: 102.","pubmedId":"","doi":"10.1186/1471-2199-9-102"},{"reference":"Moon HY, Kim OH, Kim HT, Choi JH, Yeo SY, Kim NS, et al., Kim CH. 2013. Establishment of a transgenic zebrafish EF1α:Kaede for monitoring cell. Fish Shellfish Immunol. 34: 1390-1394.","pubmedId":"","doi":"10.1016/j.fsi.2013.02.021"},{"reference":"Mosimann C, Kaufman CK, Li P, Pugach EK, Tamplin OJ, Zon LI. 2011. Ubiquitous transgene expression and Cre-based recombination driven by the. Development. 138: 169-177.","pubmedId":"","doi":"10.1242/dev.059345"},{"reference":"Rassier GT, Silveira TLR, Remiao MH, Daneluz LO, Martins AWS, Dellagostin EN, et al., Campos VF. 2020. Evaluation of qPCR reference genes in GH-overexpressing transgenic. Sci. Rep. 10: 12692.","pubmedId":"","doi":"10.1038/s41598-020-69423-y"},{"reference":"Spanjaard B, Hu B, Mitic N, Olivares Chauvet P, Janjuha S, Ninov N, Junker JP. 2018. Simultaneous lineage tracing and cell-type identification using. Nat. Biotechnol. 36: 469-473.","pubmedId":"","doi":"10.1038/nbt.4124"},{"reference":"Sur A, Wang Y, Capar P, Margolin G, Prochaska MK, Farrell JA. 2023. Single-cell analysis of shared signatures and transcriptional diversity. Dev. Cell. 58: 3028-3047.e12.","pubmedId":"","doi":"10.1016/j.devcel.2023.11.001"},{"reference":"Tang R, Dodd A, Lai D, Mc Nabb WC, Love DR. 2007. Validation of zebrafish (Danio rerio) reference genes for quantitative. Acta Biochim. Biophys. Sin. (Shanghai). 39: 384-390.","pubmedId":"","doi":"10.1111/j.1745-7270.2007.00283.x"},{"reference":"Thummel R, Burket CT, Hyde DR. 2006. Two different transgenes to study gene silencing and re-expression during. ScientificWorldJournal. 6 Suppl 1: 65-81.","pubmedId":"","doi":"10.1100/tsw.2006.328"},{"reference":"Tschanz A, Matus DQ, Swinburne I. 2025. Systematic comparison of mStayGold and mGold2 variants for live imaging in. MicroPubl. Biol. 2025","pubmedId":"","doi":"10.17912/micropub.biology.001847"},{"reference":"Tsuda N, Fukagawa R, Sueda S. 2023. Does the nuclear envelope retain its identity during mitosis?. FEBS Lett. 597: 682-692.","pubmedId":"","doi":"10.1002/1873-3468.14568"},{"reference":"Wagner DE, Weinreb C, Collins ZM, Briggs JA, Megason SG, Klein AM. 2018. Single-cell mapping of gene expression landscapes and lineage in the. Science. 360: 981-987.","pubmedId":"","doi":"10.1126/science.aar4362"},{"reference":"Xu H, Li C, Zeng Q, Agrawal I, Zhu X, Gong Z. 2016. Genome-wide identification of suitable zebrafish Danio rerio reference. J. Fish Biol. 88: 2095-2110.","pubmedId":"","doi":"10.1111/jfb.12915"}],"title":"Evaluation of eef1a1l1 expression stability and promoter-driven reporter activity during zebrafish development
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"a29a2196-c68c-480c-9fb6-2de2484276ba","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}