Understanding protein function requires tools to visualize and manipulate proteins in vivo. NanoTags, short epitope tags that are recognized by single-chain antibodies, are an emerging method for versatile in vivo labelling and manipulation of endogenous proteins. The short (13 amino acid) ALFA tag has been shown to allow labelling of endogenous proteins in several model systems, including C. elegans. Here we describe the generation and validation of transgenes to facilitate global and tissue-specific visualization of ALFA-tagged endogenous proteins in C. elegans. We propose a modular NanoTag system as a powerful approach for investigating protein functions in vivo in C. elegans.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["writing_reviewEditing","methodology","investigation"],"email":"etopalid@fredhutch.org","firstName":"Irini","lastName":"Topalidou","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-1115-4251"},{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["conceptualization","fundingAcquisition","writing_originalDraft","investigation","methodology","visualization"],"email":"nlehrbach@fredhutch.org","firstName":"Nicolas","lastName":"Lehrbach","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7342-4136"}],"awards":[{"awardId":"R35 GM142728","funderName":"National Institutes of Health (United States)","awardRecipient":"Nicolas Lehrbach"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/36598ea216159192df6076b5527de08e.jpg"},"imageCaption":"(A) Fluorescence images showing expression of NbALFA::GFP and labelling of ALFA-tagged endogenous proteins. Images of WT animals are included to show levels and localization of NbALFA::GFP in the absence of an ALFA-tagged target protein. ALFA-tagged nuclear proteins HIS-72 and LMN-1 cause increased nuclear localization of NbALFA::GFP. Expression of UNC-54 is restricted to the body wall muscle, so introduction of the tag does not alter NbALFA::GFP localization in non-muscle tissues (see panel (D) for a higher magnification image showing NbALFA::GFP-mediated labelling of UNC-54::ALFA in muscle cells).
(B) Fluorescence images showing expression of NbALFA::tagRFP and labelling of ALFA-tagged nuclear lamin LMN-1.
(C) High magnification fluorescence images showing labelling of ALFA-tagged HIS-72 and LMN-1 using NbALFA::GFP.
(D) High magnification image showing labelling of ALFA-tagged UNC-54 in the body wall muscle using NbALFA::GFP. An image of an animal in which UNC-54 is directly tagged with GFP is shown for comparison. NbALFA labelling is not as bright and is not accompanied by disruption of muscle fibers.
(E) Fluorescence images showing tissue-specific labelling of ALFA-tagged HIS-72 with NbALFA::GFP.
","imageTitle":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans
","methods":"
C. elegans husbandry.
C. elegans were maintained on standard nematode growth media (NGM) at 20°C and fed E. coli OP50 unless otherwise noted. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). The following strains were used in this study are listed below.
Strain name | Genotype | Reference |
(Yanagi et al., 2026) | ||
unc-119(kst33) III; nicTi749 [rpl-28p::NbALFA::tagRFP::tbb-2] | (Yanagi et al., 2026) | |
lmn-1(nic1723[ALFA]) I; unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
his-72(nic1725[ALFA]) III unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
unc-54(nic1731[ALFA]) I; unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
lmn-1(nic1724[ALFA]) I; unc-119(kst33) III; nicTi749[rpl-28p::NbALFA::tagRFP::tbb-2] | this study | |
this study | ||
this study | ||
this study | ||
this study | ||
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi813[myo-3p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi808[sng-1p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi823[vha-6p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi832[col-10p::NbALFA::GFP::tbb-2] | this study | |
(Arribere et al., 2016) |
Plasmid constructs and generation of transgenic animals.
All cloning was carried out using the NEBuilder HiFi DNA Assembly kit (New England Biolabs #E2621). The sequence encoding NbALFA was codon-optimized for expression in C. elegans using the transgenebuilder tool (https://www.wormbuilder.org/transgenebuilder/) and synthesized to include a single intron (from the rps-0 gene) and a C-terminal in-frame linker sequence (STSGGSGGTGGSS). Gene synthesis was carried out by Twist Biosciences. Gibson assembly was used to generate plasmids in which NbALFA fusion proteins are expressed under control of various promoters: rpl-28 promoter (ubiquitous expression, 605 bp immediately upstream of the rpl-28 ORF), myo-3 promoter (body wall muscle expression, 2139 bp immediately upstream of the myo-3 ORF), sng-1 promoter (neuronal expression, 2080 bp immediately upstream of the sng-1 ORF), vha-6 promoter (intestinal expression, 934 bp immediately upstream of the vha-6 ORF), col-10 promoter (hypodermal expression, 1126 bp immediately upstream of the col-10 ORF). All constructs are followed by the tbb-2 3'UTR (376 bp immediately downstream of the tbb-2 stop codon). These constructs were inserted into the pNL43 backbone, which contains a cbr-unc-119 rescue cassette (Lehrbach & Ruvkun, 2016). The plasmids were used to generate transgenic (miniMos insertion) animals harboring single-copy transgenes (Frokjaer-Jensen et al., 2014). Plasmids used in this study are listed below.
Plasmid | Description |
pNL549 | |
pNL559 | |
pNL594 | |
pNL595 | |
pNL596 | |
pNL598 |
Gene editing by CRISPR/Cas9.
CRISPR/Cas9 genome editing was carried out through microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1081058, #1072532, and custom crRNA) along with single-stranded oligonucleotides (IDT) as homology-directed repair (HDR) templates (Ghanta & Mello, 2020; Paix et al., 2015). All CRISPR edits were identified by diagnostic PCR and confirmed by sequencing. Guide RNAs and HDR oligos used in this study are listed below.
Edit created | Guide RNA sequence | HDR oligo sequence |
ALFA::his-72 | GGTACGAGCCATTGTTGTTC | AttctcaatttccagaacaacaATGCCAT CCCGGCTCGAGGAAGAGCTCCGTCGACGT CTCACCGAGCCAGCTCGTACCAAGCAAAC CGCTCGTAAATCC |
ALFA::lmn-1 | AGAAAAATGTCATCTCGTAA
| taactcttcagaaagcagcgagaaaaATG CCATCCCGGCTCGAGGAAGAGCTCCGTCG ACGTCTCACCGAGCCATCATCTCGTAAAG GTACTCGTAGTTCT |
unc-54::ALFA | TAATTGGACTTAGAAGTCAG
| CCATCTCGCGCCCGTGCCTCTGACTTCCC ATCCCGGCTCGAGGAAGAGCTCCGTCGAC GTCTCACCGAGTAAgtccaattactcttc aacatccct |
Microscopy
Fluorescence images were collected on a Leica M165FC equipped with a 910 Leica K5 sCMOS camera using LAS X software or on a Zeiss AxioImager Z1 equipped with an Axiocam 705 CMOS camera and using ZEN software. Worms were immobilized using sodium azide and mounted on 2% agarose pads. All images were processed and analyzed using ImageJ/Fiji software.
","reagents":"","patternDescription":"Studies of protein function rely on labelling tools to visualize or manipulate proteins in vivo. In genetically tractable model organisms such as C. elegans, CRISPR-mediated gene editing can be used to knock-in fluorescent or other functionalized tags to endogenous proteins for visualization and/or manipulation (Artan et al., 2021; Ghanta & Mello, 2020; Kurashina & Mizumoto, 2023; Schwartz et al., 2021; Zhang et al., 2015). However, directly tagging proteins of interest is not ideal for all applications. Tags such as GFP or other fluorescent proteins are valuable for protein visualization by live microscopy. However, their relatively large size can interfere with protein structure or function. Further, directly tagging endogenous loci causes labelling of the protein of interest in all tissues where it is expressed, which can complicate analysis of tissue-specific protein functions. Finally, tagging a single protein with multiple fluorescent or other functional tags requires the generation and validation of a new edited line for each tag. Expanding the repertoire and modularity of tools for endogenous protein labelling would therefore accelerate research into protein function in vivo.
NanoTags, short epitope tags that are bound at high affinity by single-chain antibodies (nanobodies, or Nbs), offer several advantages for in vivo labelling of endogenous proteins (Cheloha et al., 2020). NanoTag epitopes are typically small (~10-15 amino acids), reducing the possibility that the tag interferes with protein folding or function. Nanobodies can readily be expressed as recombinant proteins via transgenes, a strategy that has been used to label tagged proteins in various experimental systems (Igreja et al., 2022; Kim et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Virant et al., 2018; Wang et al., 2025; Xu et al., 2022; Zeghal et al., 2023). The 13 amino acid ALFA-tag is recognized with high specificity and affinity by an ALFA-specific nanobody (NbALFA) (Gotzke et al., 2019). CRISPR/Cas9 mediated knock-in of an ALFA-tag allows detection or labelling of endogenous proteins with NbALFA (Igreja et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Wang et al., 2025; Xu et al., 2022). To facilitate labelling of ALFA-tagged proteins in all tissues and developmental stages in a manner suitable for live imaging, we generated constructs in which an NbALFA::GFP or an NbALFA::tagRFP fusion is controlled by the promoter of the ubiquitously expressed rpl-28 gene. We then generated single copy insertion lines for each construct using miniMos (Frokjaer-Jensen et al., 2014). We observed diffuse nuclear and cytosolic fluorescence in NbALFA::GFP and NbALFA::tagRFP transgenic animals. To test the ability of the NbALFA fusions to recognize ALFA-tagged endogenous proteins, we used CRISPR/Cas9 to ALFA-tag highly expressed proteins with easily detectable localization patterns: his-72, encoding a histone H3.3, which is expressed in all tissues and localizes to chromatin in the nucleus; lmn-1, encoding a nuclear lamin; and unc-54, which encodes myosin heavy chain (MHC B) expressed specifically in body wall muscle. In each case, we observed localization patterns consistent with specific labelling of the endogenously tagged protein (Fig. 1A-D).
We noticed a slight increase in the overall fluorescence of NbALFA::GFP and NbALFA::tagRFP following ALFA-tagging of abundant endogenous proteins (Fig. 1A-C). This appears to be a specific effect of the interaction between the NbALFA fusion and its target protein: UNC-54 is expressed specifically in muscle, and we did not observe a change in NbALFA::GFP levels in non-muscle cells of unc-54::ALFA animals (Fig. 1A). These observations suggest that NbALFA fusion proteins are unstable when they are not bound to a target ALFA-tagged protein. A similar effect has been observed in mammalian cells, suggesting that NbALFA is generally unstable in animal cells unless bound to an ALFA-tagged target protein (Wang et al., 2025).
Labelling of endogenous proteins with fluorescent tags can, in some cases, interfere with the function of the tagged protein. GFP-tagging of LMN-1 and of the muscle myosin UNC-54 both cause sluggish locomotion, suggesting impaired function of the tagged protein (Arribere et al., 2016; Gregory et al., 2023). However, we did not observe any obvious change in locomotion of animals in which LMN-1::ALFA or UNC-54::ALFA is labelled by NbALFA::GFP. The organization of muscle filaments appears disrupted in unc-54::gfp animals but not in animals in which UNC-54::ALFA is labelled via NbALFA::GFP (Fig. 1D). These observations support that ALFA-tagging provides a means to tag and visualize the localization of endogenous proteins by live imaging without the drawbacks of direct addition of a bulky fluorescent tag that can interfere with protein structure or function.
Finally, we sought to test the possibility of using NbALFA fusion proteins to label endogenous proteins in a tissue-specific manner. We generated transgenic animals expressing NbALFA::GFP under the control of several tissue specific promoters and tested their ability to label HIS-72::ALFA in the corresponding tissues. In each case, we detected the expected increase in nuclear localization of NbALFA::GFP, indicating tissue-specific labelling of histone H3 (Fig 1E). In addition to labelling of HIS-72 in the nucleus, we observed additional cytosolic signal in some tissues, which was especially pronounced with hypodermal col-10p::NbALFA::GFP. It is possible that strong expression of tissue-specific promoters leads to increased background signal from NbALFA::GFP that is not bound to the ALFA-tagged target.
Here, we have generated a set of transgenic strains expressing NbALFA fused to fluorescent proteins to facilitate global and tissue-specific fluorescent labelling using NanoTagging in C. elegans. Because the short ALFA-tag is straightforward to introduce via CRISPR/Cas9, this toolkit can be used to quickly generate strains in which any protein of interest is labelled. Another advantage of this system is that, at least for the examples we have tested, NbALFA-mediated labelling appears to be less prone to interfere with function of the tagged protein. We have tested this system for labelling highly abundant proteins but have not yet carefully evaluated the extent of background signal (i.e. we do not know what fraction of fluorescent signal is derived from NbALFA::GFP/tagRFP molecules that are not bound to their target). The potential for background signal to complicate analysis is currently a limitation of the system. It will be important to test this system for the detection of less abundant proteins and to explore strategies for increasing labelling specificity, perhaps by using NbALFA variants whose stability or fluorescence of the attached fluorophore is dependent on binding to an ALFA-tagged target (Barykina et al., 2026; Wang et al., 2025). Improving and expanding the NanoTag toolkit will enable new applications. For example, cell-type specific promoters would allow specific labelling of endogenous proteins with greater anatomical specificity. Fusion of NbALFA to other functional partners could be used to achieve various tissue-specific manipulations. Potential applications could include tissue-specific proximity labelling, manipulation of protein localization, protein-protein interactions, or stability. Additionally, use of orthogonal NanoTag/Nb pairs can allow simultaneous labelling or manipulation of multiple proteins (van der Salm et al., 2026). In conclusion, these tools and those reported by others (Igreja et al., 2022; Quintin et al., 2025; van der Salm et al., 2026), support the potential usefulness of NanoTags in C. elegans. We hope that continued development of NanoTagging tools for C. elegans will enable new approaches to investigating protein function in vivo.
","references":[{"reference":"Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. 2016. Translation readthrough mitigation. Nature. 534: 719-23. 653.","pubmedId":"27281202","doi":"10.1038/nature18308"},{"reference":"Artan M, Barratt S, Flynn SM, Begum F, Skehel M, Nicolas A, De Bono M. 2021. Interactome analysis of Caenorhabditis elegans synapses by TurboID-based proximity labeling. J Biol Chem. 297: 101094. 455.","pubmedId":"34416233","doi":"10.1016/j.jbc.2021.101094"},{"reference":"Barykina NV, Carey EM, Oliinyk OS, Mendonca Gomes JM, De Oliveira S, Nimmerjahn A, Verkhusha VV. 2026. Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labeling and functional imaging. Nat Methods. 23: 972-985. 654.","pubmedId":"42020773","doi":"10.1038/s41592-026-03056-3"},{"reference":"Cheloha RW, Harmand TJ, Wijne C, Schwartz TU, Ploegh HL. 2020. Exploring cellular biochemistry with nanobodies. J Biol Chem. 295: 15307-15327. 530.","pubmedId":"32868455","doi":"10.1074/jbc.REV120.012960"},{"reference":"Frokjaer Jensen C, Davis MW, Sarov M, Taylor J, Flibotte S, La Bella M, et al., Jorgensen EM. 2014. Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods. 11: 529-34. 282.","pubmedId":"24820376","doi":"10.1038/nmeth.2889"},{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics. 216: 643-650. 217.","pubmedId":"32963112","doi":"10.1534/genetics.120.303564"},{"reference":"Gotzke H, Kilisch M, Martinez Carranza M, Sograte Idrissi S, Rajavel A, Schlichthaerle T, et al., Frey S. 2019. The ALFA-tag is a highly versatile tool for nanobody-based bioscience applications. Nat Commun. 10: 4403. 410.","pubmedId":"31562305","doi":"10.1038/s41467-019-12301-7"},{"reference":"Gregory EF, Ragle JM, Ward JD, Starr DA. 2023. Split-GFP lamin as a tool for studying C. elegans LMN-1 dynamics in vivo. MicroPubl Biol. 2023 652.","pubmedId":"38152058","doi":"10.17912/micropub.biology.001022"},{"reference":"Igreja C, Loschko T, Schafer A, Sharma R, Quiobe SP, Aloshy E, Witte H, Sommer RJ. 2022. Application of ALFA-Tagging in the Nematode Model Organisms Caenorhabditis elegans and Pristionchus pacificus. Cells. 11 532.","pubmedId":"36497133","doi":"10.3390/cells11233875"},{"reference":"Kim AR, Xu J, Cheloha R, Mohr SE, Zirin J, Ploegh HL, Perrimon N. 2022. NanoTag Nanobody Tools for Drosophila In Vitro and In Vivo Studies. Curr Protoc. 2: e628. 533.","pubmedId":"36571722","doi":"10.1002/cpz1.628"},{"reference":"Kurashina M, Mizumoto K. 2023. Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. STAR Protoc. 4: 102028. 527.","pubmedId":"36640369","doi":"10.1016/j.xpro.2022.102028"},{"reference":"Lehrbach NJ, Ruvkun G. 2016. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife. 5: e17721. 5.","pubmedId":"27528192","doi":"10.7554/eLife.17721"},{"reference":"Neveu J, Spielmann J, Fanara S, Delesalle C, Cantaloube S, Vert G. 2025. Broad application of plant protein tagging with ALFA tag for nanobody-based imaging and biochemical approaches. bioRxiv: 2025.03.19.644120. 651.","pubmedId":"","doi":"10.1101/2025.03.19.644120"},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 201: 47-54. 283.","pubmedId":"26187122","doi":"10.1534/genetics.115.179382"},{"reference":"Quintin S, Saad MI, Amann G, Reymann AC. 2025. In vivo detection of ALFA-tagged proteins in C. elegans with a transgenic fluorescent nanobody. MicroPubl Biol. 2025 531.","pubmedId":"40321834","doi":"10.17912/micropub.biology.001542"},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet. 17: e1009755. 529.","pubmedId":"34748534","doi":"10.1371/journal.pgen.1009755"},{"reference":"Van Der Salm E, Schroeder MH, Steller LB, Miller SI, Scheper A, Nowee G, Griffin EE, Ruijtenberg S. 2026. Epitope-based labeling for improved live-imaging of endogenous proteins in C. elegans. G3 (Bethesda) 650.","pubmedId":"42671252","doi":"10.1093/g3journal/jkag212"},{"reference":"Virant D, Traenkle B, Maier J, Kaiser PD, Bodenhofer M, Schmees C, et al., Rothbauer U. 2018. A peptide tag-specific nanobody enables high-quality labeling for dSTORM imaging. Nat Commun. 9: 930. 655.","pubmedId":"29500346","doi":"10.1038/s41467-018-03191-2"},{"reference":"Wang Z, Hu F, Xue F, He W, Yuan L, Xu P. 2025. ALFA nanobody-guided endogenous labeling. Nat Chem Biol 535.","pubmedId":"40883491","doi":"10.1038/s41589-025-02019-7"},{"reference":"Xu J, Kim AR, Cheloha RW, Fischer FA, Li JSS, Feng Y, et al., Perrimon N. 2022. Protein visualization and manipulation in Drosophila through the use of epitope tags recognized by nanobodies. Elife. 11 534.","pubmedId":"35076390","doi":"10.7554/eLife.74326"},{"reference":"Yanagi KS, Chen BJ, Kunjo SO, Topalidou I, Lehrbach N. 2026. Lysine deficiency within a conserved lysine desert is critical for EEL-1/HUWE1 to support ubiquitin proteasome system function. PLoS Genet. 22: e1012273. 657.","pubmedId":"42574471","doi":"10.1371/journal.pgen.1012273"},{"reference":"Zeghal M, Matte K, Venes A, Patel S, Laroche G, Sarvan S, et al., Giguere PM. 2023. Development of a V5-tag-directed nanobody and its implementation as an intracellular biosensor of GPCR signaling. J Biol Chem. 299: 105107. 656.","pubmedId":"37517699","doi":"10.1016/j.jbc.2023.105107"},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development. 142: 4374-84. 518.","pubmedId":"26552885","doi":"10.1242/dev.129635"}],"title":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans.
","reviews":[{"reviewer":{"displayName":"Jordan Ward"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"2cb41056-7ecc-405b-9bd2-e21c507568ca","decision":"revise","abstract":"Understanding protein function requires tools to visualize and manipulate proteins in vivo. NanoTags, short epitope tags that are recognized by single-chain antibodies, are an emerging method for versatile in vivo labelling and manipulation of endogenous proteins. The short (13 amino acid) ALFA tag has been shown to allow labelling of endogenous proteins in several model systems, including C. elegans. Here we describe the generation and validation of transgenes to facilitate global and tissue-specific visualization of ALFA-tagged endogenous proteins in C. elegans. We propose a modular NanoTag system as a powerful approach for investigating protein functions in vivo in C. elegans.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["writing_reviewEditing","methodology","investigation"],"email":"etopalid@fredhutch.org","firstName":"Irini","lastName":"Topalidou","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-1115-4251"},{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["conceptualization","fundingAcquisition","writing_originalDraft","investigation","methodology","visualization"],"email":"nlehrbach@fredhutch.org","firstName":"Nicolas","lastName":"Lehrbach","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7342-4136"}],"awards":[{"awardId":"R35 GM142728","funderName":"National Institutes of Health (United States)","awardRecipient":"Nicolas Lehrbach"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/36598ea216159192df6076b5527de08e.jpg"},"imageCaption":"(A) Fluorescence images showing expression of NbALFA::GFP and labelling of ALFA-tagged endogenous proteins. Images of WT animals are included to show levels and localization of NbALFA::GFP in the absence of an ALFA-tagged target protein. ALFA-tagged nuclear proteins HIS-72 and LMN-1 cause increased nuclear localization of NbALFA::GFP. Expression of UNC-54 is restricted to the body wall muscle, so introduction of the tag does not alter NbALFA::GFP localization in non-muscle tissues (see panel (D) for a higher magnification image showing NbALFA::GFP-mediated labelling of UNC-54::ALFA in muscle cells).
(B) Fluorescence images showing expression of NbALFA::tagRFP and labelling of ALFA-tagged nuclear lamin LMN-1.
(C) High magnification fluorescence images showing labelling of ALFA-tagged HIS-72 and LMN-1 using NbALFA::GFP.
(D) High magnification image showing labelling of ALFA-tagged UNC-54 in the body wall muscle using NbALFA::GFP. An image of an animal in which UNC-54 is directly tagged with GFP is shown for comparison. NbALFA labelling is not as bright and is not accompanied by disruption of muscle fibers.
(E) Fluorescence images showing tissue-specific labelling of ALFA-tagged HIS-72 with NbALFA::GFP.
","imageTitle":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans
","methods":"
C. elegans husbandry.
C. elegans were maintained on standard nematode growth media (NGM) at 20°C and fed E. coli OP50 unless otherwise noted. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). The following strains were used in this study are listed below.
Strain name | Genotype | Reference |
(Yanagi et al., 2026) | ||
unc-119(kst33) III; nicTi749 [rpl-28p::NbALFA::tagRFP::tbb-2] | (Yanagi et al., 2026) | |
lmn-1(nic1723[ALFA]) I; unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
his-72(nic1725[ALFA]) III unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
unc-54(nic1731[ALFA]) I; unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
lmn-1(nic1724[ALFA]) I; unc-119(kst33) III; nicTi749[rpl-28p::NbALFA::tagRFP::tbb-2] | this study | |
this study | ||
this study | ||
this study | ||
this study | ||
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi813[myo-3p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi808[sng-1p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi823[vha-6p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi832[col-10p::NbALFA::GFP::tbb-2] | this study | |
(Arribere et al., 2016) |
Plasmid constructs and generation of transgenic animals.
All cloning was carried out using the NEBuilder HiFi DNA Assembly kit (New England Biolabs #E2621). The sequence encoding NbALFA was codon-optimized for expression in C. elegans using the transgenebuilder tool (Beta Version; https://www.wormbuilder.org/transgenebuilder/) and synthesized to include a single intron (from the rps-0 gene) and a C-terminal in-frame linker sequence (STSGGSGGTGGSS). Gene synthesis was carried out by Twist Biosciences. Gibson assembly was used to generate plasmids in which NbALFA fusion proteins are expressed under control of various promoters: rpl-28 promoter (ubiquitous expression, 605 bp immediately upstream of the rpl-28 ORF), myo-3 promoter (body wall muscle expression, 2139 bp immediately upstream of the myo-3 ORF), sng-1 promoter (neuronal expression, 2080 bp immediately upstream of the sng-1 ORF), vha-6 promoter (intestinal expression, 934 bp immediately upstream of the vha-6 ORF), col-10 promoter (hypodermal expression, 1126 bp immediately upstream of the col-10 ORF). All constructs are followed by the tbb-2 3'UTR (376 bp immediately downstream of the tbb-2 stop codon). These constructs were inserted into the pNL43 backbone, which contains a cbr-unc-119 rescue cassette (Lehrbach & Ruvkun, 2016). The plasmids were used to generate transgenic (miniMos insertion) animals harboring single-copy transgenes (Frokjaer-Jensen et al., 2014). We did not systematically determine the integration sites of the miniMos insertions. We assigned linkage of one of the insertions (nicTi744), based on segregation away from markers on chromosome V. Plasmids used in this study are listed below.
Plasmid | Description |
pNL549 | |
pNL559 | |
pNL594 | |
pNL595 | |
pNL596 | |
pNL598 |
Gene editing by CRISPR/Cas9.
CRISPR/Cas9 genome editing was carried out through microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1081058, #1072532, and custom crRNA) along with single-stranded oligonucleotides (IDT) as homology-directed repair (HDR) templates (Ghanta & Mello, 2020; Paix et al., 2015). All CRISPR edits were identified by diagnostic PCR and confirmed by sequencing. Guide RNAs and HDR oligos used in this study are listed below.
Edit created | Guide RNA sequence | HDR oligo sequence |
ALFA::his-72 | GGTACGAGCCATTGTTGTTC | AttctcaatttccagaacaacaATGCCAT CCCGGCTCGAGGAAGAGCTCCGTCGACGT CTCACCGAGCCAGCTCGTACCAAGCAAAC CGCTCGTAAATCC |
ALFA::lmn-1 | AGAAAAATGTCATCTCGTAA
| taactcttcagaaagcagcgagaaaaATG CCATCCCGGCTCGAGGAAGAGCTCCGTCG ACGTCTCACCGAGCCATCATCTCGTAAAG GTACTCGTAGTTCT |
unc-54::ALFA | TAATTGGACTTAGAAGTCAG
| CCATCTCGCGCCCGTGCCTCTGACTTCCC ATCCCGGCTCGAGGAAGAGCTCCGTCGAC GTCTCACCGAGTAAgtccaattactcttc aacatccct |
Microscopy
Fluorescence images were collected on a Leica M165FC equipped with a 910 Leica K5 sCMOS camera using LAS X software (version 3.7.5.24914) or on a Zeiss AxioImager Z1 equipped with an Axiocam 705 CMOS camera and using ZEN software (version 3.3.89.0003). Worms were immobilized using sodium azide and mounted on 2% agarose pads. All images were processed and analyzed using ImageJ/Fiji software (version 2.16.0/1.54p).
","reagents":"","patternDescription":"Studies of protein function rely on labelling tools to visualize or manipulate proteins in vivo. In genetically tractable model organisms such as C. elegans, CRISPR-mediated gene editing can be used to knock-in fluorescent or other functionalized tags to endogenous proteins for visualization and/or manipulation (Artan et al., 2021; Ghanta & Mello, 2020; Kurashina & Mizumoto, 2023; Schwartz et al., 2021; Zhang et al., 2015). However, directly tagging proteins of interest is not ideal for all applications. Tags such as GFP or other fluorescent proteins are valuable for protein visualization by live microscopy. However, their relatively large size can interfere with protein structure or function. Further, directly tagging endogenous loci causes labelling of the protein of interest in all tissues where it is expressed, which can complicate analysis of tissue-specific protein functions. Finally, tagging a single protein with multiple fluorescent or other functional tags requires the generation and validation of a new edited line for each tag. Expanding the repertoire and modularity of tools for endogenous protein labelling would therefore accelerate research into protein function in vivo.
NanoTags, short epitope tags that are bound at high affinity by single-chain antibodies (nanobodies, or Nbs), offer several advantages for in vivo labelling of endogenous proteins (Cheloha et al., 2020). NanoTag epitopes are typically small (~10-15 amino acids), reducing the possibility that the tag interferes with protein folding or function. Nanobodies can readily be expressed as recombinant proteins via transgenes, a strategy that has been used to label tagged proteins in various experimental systems (Igreja et al., 2022; Kim et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Virant et al., 2018; Wang et al., 2025; Xu et al., 2022; Zeghal et al., 2023). The 13 amino acid ALFA-tag is recognized with high specificity and affinity by an ALFA-specific nanobody (NbALFA) (Gotzke et al., 2019). CRISPR/Cas9 mediated knock-in of an ALFA-tag allows detection or labelling of endogenous proteins with NbALFA (Igreja et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Wang et al., 2025; Xu et al., 2022). To facilitate labelling of ALFA-tagged proteins in all tissues and developmental stages in a manner suitable for live imaging, we generated constructs in which an NbALFA::GFP or an NbALFA::tagRFP fusion is controlled by the promoter of the ubiquitously expressed rpl-28 gene. We then generated single copy insertion lines for each construct using miniMos (Frokjaer-Jensen et al., 2014). We observed diffuse nuclear and cytosolic fluorescence in NbALFA::GFP and NbALFA::tagRFP transgenic animals. To test the ability of the NbALFA fusions to recognize ALFA-tagged endogenous proteins, we used CRISPR/Cas9 to ALFA-tag highly expressed proteins with easily detectable localization patterns: his-72, encoding a histone H3.3, which is expressed in all tissues and localizes to chromatin in the nucleus; lmn-1, encoding a nuclear lamin; and unc-54, which encodes myosin heavy chain (MHC B) expressed specifically in body wall muscle. In each case, we observed localization patterns consistent with specific labelling of the endogenously tagged protein (Fig. 1A-D).
We noticed a slight increase in the overall fluorescence of NbALFA::GFP and NbALFA::tagRFP following ALFA-tagging of abundant endogenous proteins (Fig. 1A-C). This appears to be a specific effect of the interaction between the NbALFA fusion and its target protein: UNC-54 is expressed specifically in muscle, and we did not observe a change in NbALFA::GFP levels in non-muscle cells of unc-54::ALFA animals (Fig. 1A). These observations suggest that NbALFA fusion proteins are unstable when they are not bound to a target ALFA-tagged protein. A similar effect has been observed in mammalian cells, suggesting that NbALFA is generally unstable in animal cells unless bound to an ALFA-tagged target protein (Wang et al., 2025).
Labelling of endogenous proteins with fluorescent tags can, in some cases, interfere with the function of the tagged protein. GFP-tagging of LMN-1 and of the muscle myosin UNC-54 both cause sluggish locomotion, suggesting impaired function of the tagged protein (Arribere et al., 2016; Gregory et al., 2023). However, we did not observe any obvious change in locomotion of animals in which LMN-1::ALFA or UNC-54::ALFA is labelled by NbALFA::GFP. The organization of muscle filaments appears disrupted in unc-54::gfp animals but not in animals in which UNC-54::ALFA is labelled via NbALFA::GFP (Fig. 1D). These observations support that ALFA-tagging provides a means to tag and visualize the localization of endogenous proteins by live imaging without the drawbacks of direct addition of a bulky fluorescent tag that can interfere with protein structure or function.
Finally, we sought to test the possibility of using NbALFA fusion proteins to label endogenous proteins in a tissue-specific manner. We generated transgenic animals expressing NbALFA::GFP under the control of several tissue specific promoters and tested their ability to label HIS-72::ALFA in the corresponding tissues. In each case, we detected the expected increase in nuclear localization of NbALFA::GFP, indicating tissue-specific labelling of histone H3 (Fig 1E). In addition to labelling of HIS-72 in the nucleus, we observed additional cytosolic signal in some tissues, which was especially pronounced with hypodermal col-10p::NbALFA::GFP. It is possible that strong expression of tissue-specific promoters leads to increased background signal from NbALFA::GFP that is not bound to the ALFA-tagged target.
Here, we have generated transgenic strains expressing NbALFA fused to fluorescent proteins to facilitate global and tissue-specific fluorescent labelling using NanoTagging in C. elegans. Our work provides new ways to achieve labelling in entire animals or in specific somatic tissues, which complements tools for labelling ALFA-tagged proteins in C. elegans already generated by other groups (Quintin et al., 2025; van der Salm et al., 2026). Importantly, van der Salm and colleagues’ work demonstrates the use of orthogonal labelling strategies in combination with the ALFA tag for simultaneous live imaging of multiple proteins and discusses the advantages of indirect labelling in detail (van der Salm et al., 2026). We note that the transgenes we generated are randomly inserted into the genome via miniMos and we have not systematically determined their integration sites. Insertions of similar transgenes for tissue-specific NbALFA labelling at defined safe-harbor loci would improve their utility.
Because the short ALFA-tag is straightforward to introduce via CRISPR/Cas9, these tools can be used to quickly generate strains in which any protein of interest is labelled. We tested this system for labelling highly abundant proteins but have not yet carefully evaluated the extent of background signal (i.e. we do not know what fraction of fluorescent signal is derived from NbALFA::GFP/tagRFP molecules that are not bound to their target). This caveat of the ALFA-tagging approach contrasts with split-GFP labelling, in which the fluorophore is reconstituted upon binding to the target protein, yielding minimal background signal (Feng et al., 2019; He et al., 2019; Hefel & Smolikove, 2019; Noma et al., 2017). ALFA-tagging may be an attractive alternative to split-GFP in cases where background signal is not a concern, or where maximizing signal is important, since reconstituted split-GFP is much dimmer than intact GFP (Feng et al., 2019). Given the potential for background signal to complicate analysis, it will be important to test the ALFA system for detection of less abundant proteins and to explore strategies for increasing labelling specificity, perhaps by using NbALFA variants whose stability or fluorescence of the attached fluorophore is dependent on binding to an ALFA-tagged target (Barykina et al., 2026; Wang et al., 2025). Labelling efficiency could also be enhanced by incorporating multiple tags in tandem to a target protein, as van der Salm and colleagues demonstrate using the SunTag System.
Improving and expanding the NanoTag toolkit will enable new applications. For example, cell-type specific promoters would allow specific labelling of endogenous proteins with greater anatomical specificity. Fusion of NbALFA to other functional partners could be used to achieve various tissue-specific manipulations. Potential applications could include tissue-specific proximity labelling, manipulation of protein localization, protein-protein interactions, or stability. In conclusion, these tools and those reported by others (Igreja et al., 2022; Quintin et al., 2025; van der Salm et al., 2026), support the usefulness of NanoTags in C. elegans. We hope that continued development of NanoTagging tools for C. elegans will enable new approaches to investigating protein function in vivo.
","references":[{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics. 216: 643-650. 217.","pubmedId":"32963112","doi":"10.1534/genetics.120.303564"},{"reference":"Lehrbach NJ, Ruvkun G. 2016. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife. 5: e17721. 5.","pubmedId":"27528192","doi":"10.7554/eLife.17721"},{"reference":"Frokjaer Jensen C, Davis MW, Sarov M, Taylor J, Flibotte S, La Bella M, et al., Jorgensen EM. 2014. Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods. 11: 529-34. 282.","pubmedId":"24820376","doi":"10.1038/nmeth.2889"},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 201: 47-54. 283.","pubmedId":"26187122","doi":"10.1534/genetics.115.179382"},{"reference":"Gotzke H, Kilisch M, Martinez Carranza M, Sograte Idrissi S, Rajavel A, Schlichthaerle T, et al., Frey S. 2019. The ALFA-tag is a highly versatile tool for nanobody-based bioscience applications. Nat Commun. 10: 4403. 410.","pubmedId":"31562305","doi":"10.1038/s41467-019-12301-7"},{"reference":"Artan M, Barratt S, Flynn SM, Begum F, Skehel M, Nicolas A, De Bono M. 2021. Interactome analysis of Caenorhabditis elegans synapses by TurboID-based proximity labeling. J Biol Chem. 297: 101094. 455.","pubmedId":"34416233","doi":"10.1016/j.jbc.2021.101094"},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development. 142: 4374-84. 518.","pubmedId":"26552885","doi":"10.1242/dev.129635"},{"reference":"Kurashina M, Mizumoto K. 2023. Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. STAR Protoc. 4: 102028. 527.","pubmedId":"36640369","doi":"10.1016/j.xpro.2022.102028"},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet. 17: e1009755. 529.","pubmedId":"34748534","doi":"10.1371/journal.pgen.1009755"},{"reference":"Cheloha RW, Harmand TJ, Wijne C, Schwartz TU, Ploegh HL. 2020. Exploring cellular biochemistry with nanobodies. J Biol Chem. 295: 15307-15327. 530.","pubmedId":"32868455","doi":"10.1074/jbc.REV120.012960"},{"reference":"Quintin S, Saad MI, Amann G, Reymann AC. 2025. In vivo detection of ALFA-tagged proteins in C. elegans with a transgenic fluorescent nanobody. MicroPubl Biol. 2025 531.","pubmedId":"40321834","doi":"10.17912/micropub.biology.001542"},{"reference":"Igreja C, Loschko T, Schafer A, Sharma R, Quiobe SP, Aloshy E, Witte H, Sommer RJ. 2022. Application of ALFA-Tagging in the Nematode Model Organisms Caenorhabditis elegans and Pristionchus pacificus. Cells. 11 532.","pubmedId":"36497133","doi":"10.3390/cells11233875"},{"reference":"Kim AR, Xu J, Cheloha R, Mohr SE, Zirin J, Ploegh HL, Perrimon N. 2022. NanoTag Nanobody Tools for Drosophila In Vitro and In Vivo Studies. Curr Protoc. 2: e628. 533.","pubmedId":"36571722","doi":"10.1002/cpz1.628"},{"reference":"Xu J, Kim AR, Cheloha RW, Fischer FA, Li JSS, Feng Y, et al., Perrimon N. 2022. Protein visualization and manipulation in Drosophila through the use of epitope tags recognized by nanobodies. Elife. 11 534.","pubmedId":"35076390","doi":"10.7554/eLife.74326"},{"reference":"Wang Z, Hu F, Xue F, He W, Yuan L, Xu P. 2025. ALFA nanobody-guided endogenous labeling. Nat Chem Biol 535.","pubmedId":"40883491","doi":"10.1038/s41589-025-02019-7"},{"reference":"Van Der Salm E, Schroeder MH, Steller LB, Miller SI, Scheper A, Nowee G, Griffin EE, Ruijtenberg S. 2026. Epitope-based labeling for improved live-imaging of endogenous proteins in C. elegans. G3 (Bethesda) 650.","pubmedId":"42671252","doi":"10.1093/g3journal/jkag212"},{"reference":"Neveu J, Spielmann J, Fanara S, Delesalle C, Cantaloube S, Vert G. 2025. Broad application of plant protein tagging with ALFA tag for nanobody-based imaging and biochemical approaches. bioRxiv: 2025.03.19.644120. 651.","pubmedId":"","doi":"10.1101/2025.03.19.644120"},{"reference":"Gregory EF, Ragle JM, Ward JD, Starr DA. 2023. Split-GFP lamin as a tool for studying C. elegans LMN-1 dynamics in vivo. MicroPubl Biol. 2023 652.","pubmedId":"38152058","doi":"10.17912/micropub.biology.001022"},{"reference":"Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. 2016. Translation readthrough mitigation. Nature. 534: 719-23. 653.","pubmedId":"27281202","doi":"10.1038/nature18308"},{"reference":"Barykina NV, Carey EM, Oliinyk OS, Mendonca Gomes JM, De Oliveira S, Nimmerjahn A, Verkhusha VV. 2026. Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labeling and functional imaging. Nat Methods. 23: 972-985. 654.","pubmedId":"42020773","doi":"10.1038/s41592-026-03056-3"},{"reference":"Virant D, Traenkle B, Maier J, Kaiser PD, Bodenhofer M, Schmees C, et al., Rothbauer U. 2018. A peptide tag-specific nanobody enables high-quality labeling for dSTORM imaging. Nat Commun. 9: 930. 655.","pubmedId":"29500346","doi":"10.1038/s41467-018-03191-2"},{"reference":"Zeghal M, Matte K, Venes A, Patel S, Laroche G, Sarvan S, et al., Giguere PM. 2023. Development of a V5-tag-directed nanobody and its implementation as an intracellular biosensor of GPCR signaling. J Biol Chem. 299: 105107. 656.","pubmedId":"37517699","doi":"10.1016/j.jbc.2023.105107"},{"reference":"Yanagi KS, Chen BJ, Kunjo SO, Topalidou I, Lehrbach N. 2026. Lysine deficiency within a conserved lysine desert is critical for EEL-1/HUWE1 to support ubiquitin proteasome system function. PLoS Genet. 22: e1012273. 657.","pubmedId":"42574471","doi":"10.1371/journal.pgen.1012273"},{"reference":"Hefel A, Smolikove S. 2019. Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline. G3 (Bethesda). 9: 1933-1943. 658.","pubmedId":"30992318","doi":"10.1534/g3.119.400162"},{"reference":"He S, Cuentas Condori A, Miller DM. 2019. NATF (Native and Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. Genetics. 212: 387-395. 659.","pubmedId":"30952669","doi":"10.1534/genetics.119.302063"},{"reference":"Feng S, Varshney A, Coto Villa D, Modavi C, Kohler J, Farah F, et al., Huang B. 2019. Bright split red fluorescent proteins for the visualization of endogenous proteins and synapses. Commun Biol. 2: 344. 660.","pubmedId":"31552297","doi":"10.1038/s42003-019-0589-x"},{"reference":"Noma K, Goncharov A, Ellisman MH, Jin Y. 2017. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 6 661.","pubmedId":"28767038","doi":"10.7554/eLife.26376"}],"title":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans.
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"bb98e325-4287-4ed3-9093-a9246f067ff8","decision":"accept","abstract":"Understanding protein function requires tools to visualize and manipulate proteins in vivo. NanoTags, short epitope tags that are recognized by single-chain antibodies, are an emerging method for versatile in vivo labelling and manipulation of endogenous proteins. The short (13 amino acid) ALFA tag has been shown to allow labelling of endogenous proteins in several model systems, including C. elegans. Here we describe the generation and validation of transgenes to facilitate global and tissue-specific visualization of ALFA-tagged endogenous proteins in C. elegans. We propose a modular NanoTag system as a powerful approach for investigating protein functions in vivo in C. elegans.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["writing_reviewEditing","methodology","investigation"],"email":"etopalid@fredhutch.org","firstName":"Irini","lastName":"Topalidou","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-1115-4251"},{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["conceptualization","fundingAcquisition","writing_originalDraft","investigation","methodology","visualization"],"email":"nlehrbach@fredhutch.org","firstName":"Nicolas","lastName":"Lehrbach","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7342-4136"}],"awards":[{"awardId":"R35 GM142728","funderName":"National Institutes of Health (United States)","awardRecipient":"Nicolas Lehrbach"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/36598ea216159192df6076b5527de08e.jpg"},"imageCaption":"(A) Fluorescence images showing expression of NbALFA::GFP and labelling of ALFA-tagged endogenous proteins. Images of WT animals are included to show levels and localization of NbALFA::GFP in the absence of an ALFA-tagged target protein. ALFA-tagged nuclear proteins HIS-72 and LMN-1 cause increased nuclear localization of NbALFA::GFP. Expression of UNC-54 is restricted to the body wall muscle, so introduction of the tag does not alter NbALFA::GFP localization in non-muscle tissues (see panel (D) for a higher magnification image showing NbALFA::GFP-mediated labelling of UNC-54::ALFA in muscle cells).
(B) Fluorescence images showing expression of NbALFA::tagRFP and labelling of ALFA-tagged nuclear lamin LMN-1.
(C) High magnification fluorescence images showing labelling of ALFA-tagged HIS-72 and LMN-1 using NbALFA::GFP.
(D) High magnification image showing labelling of ALFA-tagged UNC-54 in the body wall muscle using NbALFA::GFP. An image of an animal in which UNC-54 is directly tagged with GFP is shown for comparison. NbALFA labelling is not as bright and is not accompanied by disruption of muscle fibers.
(E) Fluorescence images showing tissue-specific labelling of ALFA-tagged HIS-72 with NbALFA::GFP.
","imageTitle":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans
","methods":"
C. elegans husbandry.
C. elegans were maintained on standard nematode growth media (NGM) at 20°C and fed E. coli OP50 unless otherwise noted. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). The following strains were used in this study are listed below.
Strain name | Genotype | Reference |
(Yanagi et al., 2026) | ||
unc-119(kst33) III; nicTi749 [rpl-28p::NbALFA::tagRFP::tbb-2] | (Yanagi et al., 2026) | |
lmn-1(nic1723[ALFA]) I; unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
his-72(nic1725[ALFA]) III unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
unc-54(nic1731[ALFA]) I; unc-119(kst33) III; nicTi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
lmn-1(nic1724[ALFA]) I; unc-119(kst33) III; nicTi749[rpl-28p::NbALFA::tagRFP::tbb-2] | this study | |
this study | ||
this study | ||
this study | ||
this study | ||
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi813[myo-3p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi808[sng-1p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi823[vha-6p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicTi832[col-10p::NbALFA::GFP::tbb-2] | this study | |
(Arribere et al., 2016) |
Plasmid constructs and generation of transgenic animals.
All cloning was carried out using the NEBuilder HiFi DNA Assembly kit (New England Biolabs #E2621). The sequence encoding NbALFA was codon-optimized for expression in C. elegans using the transgenebuilder tool (Beta Version; https://www.wormbuilder.org/transgenebuilder/) and synthesized to include a single intron (from the rps-0 gene) and a C-terminal in-frame linker sequence (STSGGSGGTGGSS). Gene synthesis was carried out by Twist Biosciences. Gibson assembly was used to generate plasmids in which NbALFA fusion proteins are expressed under control of various promoters: rpl-28 promoter (ubiquitous expression, 605 bp immediately upstream of the rpl-28 ORF), myo-3 promoter (body wall muscle expression, 2139 bp immediately upstream of the myo-3 ORF), sng-1 promoter (neuronal expression, 2080 bp immediately upstream of the sng-1 ORF), vha-6 promoter (intestinal expression, 934 bp immediately upstream of the vha-6 ORF), col-10 promoter (hypodermal expression, 1126 bp immediately upstream of the col-10 ORF). All constructs are followed by the tbb-2 3'UTR (376 bp immediately downstream of the tbb-2 stop codon). These constructs were inserted into the pNL43 backbone, which contains a cbr-unc-119 rescue cassette (Lehrbach & Ruvkun, 2016). The plasmids were used to generate transgenic (miniMos insertion) animals harboring single-copy transgenes (Frokjaer-Jensen et al., 2014). We did not systematically determine the integration sites of the miniMos insertions. We assigned linkage of one of the insertions (nicTi744), based on segregation away from markers on chromosome V. Plasmids used in this study are listed below.
Plasmid | Description |
pNL549 | |
pNL559 | |
pNL594 | |
pNL595 | |
pNL596 | |
pNL598 |
Gene editing by CRISPR/Cas9.
CRISPR/Cas9 genome editing was carried out through microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1081058, #1072532, and custom crRNA) along with single-stranded oligonucleotides (IDT) as homology-directed repair (HDR) templates (Ghanta & Mello, 2020; Paix et al., 2015). All CRISPR edits were identified by diagnostic PCR and confirmed by sequencing. Guide RNAs and HDR oligos used in this study are listed below.
Edit created | Guide RNA sequence | HDR oligo sequence |
ALFA::his-72 | GGTACGAGCCATTGTTGTTC | AttctcaatttccagaacaacaATGCCAT CCCGGCTCGAGGAAGAGCTCCGTCGACGT CTCACCGAGCCAGCTCGTACCAAGCAAAC CGCTCGTAAATCC |
ALFA::lmn-1 | AGAAAAATGTCATCTCGTAA
| taactcttcagaaagcagcgagaaaaATG CCATCCCGGCTCGAGGAAGAGCTCCGTCG ACGTCTCACCGAGCCATCATCTCGTAAAG GTACTCGTAGTTCT |
unc-54::ALFA | TAATTGGACTTAGAAGTCAG
| CCATCTCGCGCCCGTGCCTCTGACTTCCC ATCCCGGCTCGAGGAAGAGCTCCGTCGAC GTCTCACCGAGTAAgtccaattactcttc aacatccct |
Microscopy
Fluorescence images were collected on a Leica M165FC equipped with a 910 Leica K5 sCMOS camera using LAS X software (version 3.7.5.24914) or on a Zeiss AxioImager Z1 equipped with an Axiocam 705 CMOS camera and using ZEN software (version 3.3.89.0003). Worms were immobilized using sodium azide and mounted on 2% agarose pads. All images were processed and analyzed using ImageJ/Fiji software (version 2.16.0/1.54p).
","reagents":"","patternDescription":"Studies of protein function rely on labelling tools to visualize or manipulate proteins in vivo. In genetically tractable model organisms such as C. elegans, CRISPR-mediated gene editing can be used to knock-in fluorescent or other functionalized tags to endogenous proteins for visualization and/or manipulation (Artan et al., 2021; Ghanta & Mello, 2020; Kurashina & Mizumoto, 2023; Schwartz et al., 2021; Zhang et al., 2015). However, directly tagging proteins of interest is not ideal for all applications. Tags such as GFP or other fluorescent proteins are valuable for protein visualization by live microscopy. However, their relatively large size can interfere with protein structure or function. Further, directly tagging endogenous loci causes labelling of the protein of interest in all tissues where it is expressed, which can complicate analysis of tissue-specific protein functions. Finally, tagging a single protein with multiple fluorescent or other functional tags requires the generation and validation of a new edited line for each tag. Expanding the repertoire and modularity of tools for endogenous protein labelling would therefore accelerate research into protein function in vivo.
NanoTags, short epitope tags that are bound at high affinity by single-chain antibodies (nanobodies, or Nbs), offer several advantages for in vivo labelling of endogenous proteins (Cheloha et al., 2020). NanoTag epitopes are typically small (~10-15 amino acids), reducing the possibility that the tag interferes with protein folding or function. Nanobodies can readily be expressed as recombinant proteins via transgenes, a strategy that has been used to label tagged proteins in various experimental systems (Igreja et al., 2022; Kim et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Virant et al., 2018; Wang et al., 2025; Xu et al., 2022; Zeghal et al., 2023). The 13 amino acid ALFA-tag is recognized with high specificity and affinity by an ALFA-specific nanobody (NbALFA) (Gotzke et al., 2019). CRISPR/Cas9 mediated knock-in of an ALFA-tag allows detection or labelling of endogenous proteins with NbALFA (Igreja et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Wang et al., 2025; Xu et al., 2022). Transgenic strains that express NbALFA fusions in C. elegans germline have been produced by two labs (NbALFA::mKate2, Quintin et al., 2025 and NbALFA::HaloTag, van der Salm et al., 2026) and shown to enable live imaging of ALFA-tagged endogenous proteins in the germline and embryos. Here, we confirm the broad utility of NbALFA for labelling endogenous proteins, by using transgenes to drive whole-animal and tissue-specific expression of NbALFA fusion proteins.
We generated constructs in which an NbALFA::GFP or an NbALFA::tagRFP fusion is controlled by the promoter of the ubiquitously expressed rpl-28 gene. We then generated single copy insertion lines for each construct using miniMos (Frokjaer-Jensen et al., 2014). We observed diffuse nuclear and cytosolic fluorescence in NbALFA::GFP and NbALFA::tagRFP transgenic animals. To test the ability of the NbALFA fusions to recognize ALFA-tagged endogenous proteins, we used CRISPR/Cas9 to ALFA-tag highly expressed proteins with easily detectable localization patterns: his-72, encoding a histone H3.3, which is expressed in all tissues and localizes to chromatin in the nucleus; lmn-1, encoding a nuclear lamin; and unc-54, which encodes myosin heavy chain (MHC B) expressed specifically in body wall muscle. In each case, we observed localization patterns consistent with specific labelling of the endogenously tagged protein (Fig. 1A-D).
We noticed a slight increase in the overall fluorescence of NbALFA::GFP and NbALFA::tagRFP following ALFA-tagging of abundant endogenous proteins (Fig. 1A-C). This appears to be a specific effect of the interaction between the NbALFA fusion and its target protein: UNC-54 is expressed specifically in muscle, and we did not observe a change in NbALFA::GFP levels in non-muscle cells of unc-54::ALFA animals (Fig. 1A). These observations suggest that NbALFA fusion proteins are unstable when they are not bound to a target ALFA-tagged protein. A similar effect has been observed in mammalian cells, suggesting that NbALFA is generally unstable in animal cells unless bound to an ALFA-tagged target protein (Wang et al., 2025).
Labelling of endogenous proteins with fluorescent tags can, in some cases, interfere with the function of the tagged protein. GFP-tagging of LMN-1 and of the muscle myosin UNC-54 both cause sluggish locomotion, suggesting impaired function of the tagged protein (Arribere et al., 2016; Gregory et al., 2023). However, we did not observe any obvious change in locomotion of animals in which LMN-1::ALFA or UNC-54::ALFA is labelled by NbALFA::GFP. The organization of muscle filaments appears disrupted in unc-54::gfp animals but not in animals in which UNC-54::ALFA is labelled via NbALFA::GFP (Fig. 1D). These observations support that ALFA-tagging provides a means to tag and visualize the localization of endogenous proteins by live imaging without the drawbacks of direct addition of a bulky fluorescent tag that can interfere with protein structure or function.
Finally, we sought to test the possibility of using NbALFA fusion proteins to label endogenous proteins in a tissue-specific manner. We generated transgenic animals expressing NbALFA::GFP under the control of several tissue specific promoters and tested their ability to label HIS-72::ALFA in the corresponding tissues. In each case, we detected the expected increase in nuclear localization of NbALFA::GFP, indicating tissue-specific labelling of histone H3 (Fig 1E). In addition to labelling of HIS-72 in the nucleus, we observed additional cytosolic signal in some tissues, which was especially pronounced with hypodermal col-10p::NbALFA::GFP. It is possible that strong expression of tissue-specific promoters leads to increased background signal from NbALFA::GFP that is not bound to the ALFA-tagged target.
Here, we have generated transgenic strains expressing NbALFA fused to fluorescent proteins to facilitate global and tissue-specific fluorescent labelling using NanoTagging in C. elegans. Our work provides new ways to achieve labelling in entire animals or in specific somatic tissues, which complements tools for labelling ALFA-tagged proteins in C. elegans already generated by other groups (Quintin et al., 2025; van der Salm et al., 2026). Importantly, van der Salm and colleagues' work demonstrates the use of orthogonal labelling strategies in combination with the ALFA tag for simultaneous live imaging of multiple proteins and discusses the advantages of indirect labelling in detail (van der Salm et al., 2026). We note that the transgenes we generated are randomly inserted into the genome via miniMos and we have not systematically determined their integration sites. Insertions of similar transgenes for tissue-specific NbALFA labelling at defined safe-harbor loci would improve their utility.
Because the short ALFA-tag is straightforward to introduce via CRISPR/Cas9, these tools can be used to quickly generate strains in which any protein of interest is labelled. We tested this system for labelling highly abundant proteins but have not yet carefully evaluated the extent of background signal (i.e. we do not know what fraction of fluorescent signal is derived from NbALFA::GFP/tagRFP molecules that are not bound to their target). This caveat of the ALFA-tagging approach contrasts with split-GFP labelling, in which the fluorophore is reconstituted upon binding to the target protein, yielding minimal background signal (Feng et al., 2019; He et al., 2019; Hefel & Smolikove, 2019; Noma et al., 2017). ALFA-tagging may be an attractive alternative to split-GFP in cases where background signal is not a concern, or where maximizing signal is important, since reconstituted split-GFP is much dimmer than intact GFP (Feng et al., 2019). Given the potential for background signal to complicate analysis, it will be important to test the ALFA system for detection of less abundant proteins and to explore strategies for increasing labelling specificity, perhaps by using NbALFA variants whose stability or fluorescence of the attached fluorophore is dependent on binding to an ALFA-tagged target (Barykina et al., 2026; Wang et al., 2025). Labelling efficiency could also be enhanced by incorporating multiple tags in tandem to a target protein, as van der Salm and colleagues demonstrate using the SunTag System.
Improving and expanding the NanoTag toolkit will enable new applications. For example, cell-type specific promoters would allow specific labelling of endogenous proteins with greater anatomical specificity. Fusion of NbALFA to other functional partners could be used to achieve various tissue-specific manipulations. Potential applications could include tissue-specific proximity labelling, manipulation of protein localization, protein-protein interactions, or stability. In conclusion, these tools and those reported by others (Igreja et al., 2022; Quintin et al., 2025; van der Salm et al., 2026), support the usefulness of NanoTags in C. elegans. We hope that continued development of NanoTagging tools for C. elegans will enable new approaches to investigating protein function in vivo.
","references":[{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics. 216: 643-650. 217.","pubmedId":"32963112","doi":"10.1534/genetics.120.303564"},{"reference":"Lehrbach NJ, Ruvkun G. 2016. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife. 5: e17721. 5.","pubmedId":"27528192","doi":"10.7554/eLife.17721"},{"reference":"Frokjaer Jensen C, Davis MW, Sarov M, Taylor J, Flibotte S, La Bella M, et al., Jorgensen EM. 2014. Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods. 11: 529-34. 282.","pubmedId":"24820376","doi":"10.1038/nmeth.2889"},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 201: 47-54. 283.","pubmedId":"26187122","doi":"10.1534/genetics.115.179382"},{"reference":"Gotzke H, Kilisch M, Martinez Carranza M, Sograte Idrissi S, Rajavel A, Schlichthaerle T, et al., Frey S. 2019. The ALFA-tag is a highly versatile tool for nanobody-based bioscience applications. Nat Commun. 10: 4403. 410.","pubmedId":"31562305","doi":"10.1038/s41467-019-12301-7"},{"reference":"Artan M, Barratt S, Flynn SM, Begum F, Skehel M, Nicolas A, De Bono M. 2021. Interactome analysis of Caenorhabditis elegans synapses by TurboID-based proximity labeling. J Biol Chem. 297: 101094. 455.","pubmedId":"34416233","doi":"10.1016/j.jbc.2021.101094"},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development. 142: 4374-84. 518.","pubmedId":"26552885","doi":"10.1242/dev.129635"},{"reference":"Kurashina M, Mizumoto K. 2023. Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. STAR Protoc. 4: 102028. 527.","pubmedId":"36640369","doi":"10.1016/j.xpro.2022.102028"},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet. 17: e1009755. 529.","pubmedId":"34748534","doi":"10.1371/journal.pgen.1009755"},{"reference":"Cheloha RW, Harmand TJ, Wijne C, Schwartz TU, Ploegh HL. 2020. Exploring cellular biochemistry with nanobodies. J Biol Chem. 295: 15307-15327. 530.","pubmedId":"32868455","doi":"10.1074/jbc.REV120.012960"},{"reference":"Quintin S, Saad MI, Amann G, Reymann AC. 2025. In vivo detection of ALFA-tagged proteins in C. elegans with a transgenic fluorescent nanobody. MicroPubl Biol. 2025 531.","pubmedId":"40321834","doi":"10.17912/micropub.biology.001542"},{"reference":"Igreja C, Loschko T, Schafer A, Sharma R, Quiobe SP, Aloshy E, Witte H, Sommer RJ. 2022. Application of ALFA-Tagging in the Nematode Model Organisms Caenorhabditis elegans and Pristionchus pacificus. Cells. 11 532.","pubmedId":"36497133","doi":"10.3390/cells11233875"},{"reference":"Kim AR, Xu J, Cheloha R, Mohr SE, Zirin J, Ploegh HL, Perrimon N. 2022. NanoTag Nanobody Tools for Drosophila In Vitro and In Vivo Studies. Curr Protoc. 2: e628. 533.","pubmedId":"36571722","doi":"10.1002/cpz1.628"},{"reference":"Xu J, Kim AR, Cheloha RW, Fischer FA, Li JSS, Feng Y, et al., Perrimon N. 2022. Protein visualization and manipulation in Drosophila through the use of epitope tags recognized by nanobodies. Elife. 11 534.","pubmedId":"35076390","doi":"10.7554/eLife.74326"},{"reference":"Wang Z, Hu F, Xue F, He W, Yuan L, Xu P. 2025. ALFA nanobody-guided endogenous labeling. Nat Chem Biol 535.","pubmedId":"40883491","doi":"10.1038/s41589-025-02019-7"},{"reference":"Van Der Salm E, Schroeder MH, Steller LB, Miller SI, Scheper A, Nowee G, Griffin EE, Ruijtenberg S. 2026. Epitope-based labeling for improved live-imaging of endogenous proteins in C. elegans. G3 (Bethesda) 650.","pubmedId":"42671252","doi":"10.1093/g3journal/jkag212"},{"reference":"Neveu J, Spielmann J, Fanara S, Delesalle C, Cantaloube S, Vert G. 2025. Broad application of plant protein tagging with ALFA tag for nanobody-based imaging and biochemical approaches. bioRxiv: 2025.03.19.644120. 651.","pubmedId":"","doi":"10.1101/2025.03.19.644120"},{"reference":"Gregory EF, Ragle JM, Ward JD, Starr DA. 2023. Split-GFP lamin as a tool for studying C. elegans LMN-1 dynamics in vivo. MicroPubl Biol. 2023 652.","pubmedId":"38152058","doi":"10.17912/micropub.biology.001022"},{"reference":"Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. 2016. Translation readthrough mitigation. Nature. 534: 719-23. 653.","pubmedId":"27281202","doi":"10.1038/nature18308"},{"reference":"Barykina NV, Carey EM, Oliinyk OS, Mendonca Gomes JM, De Oliveira S, Nimmerjahn A, Verkhusha VV. 2026. Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labeling and functional imaging. Nat Methods. 23: 972-985. 654.","pubmedId":"42020773","doi":"10.1038/s41592-026-03056-3"},{"reference":"Virant D, Traenkle B, Maier J, Kaiser PD, Bodenhofer M, Schmees C, et al., Rothbauer U. 2018. A peptide tag-specific nanobody enables high-quality labeling for dSTORM imaging. Nat Commun. 9: 930. 655.","pubmedId":"29500346","doi":"10.1038/s41467-018-03191-2"},{"reference":"Zeghal M, Matte K, Venes A, Patel S, Laroche G, Sarvan S, et al., Giguere PM. 2023. Development of a V5-tag-directed nanobody and its implementation as an intracellular biosensor of GPCR signaling. J Biol Chem. 299: 105107. 656.","pubmedId":"37517699","doi":"10.1016/j.jbc.2023.105107"},{"reference":"Yanagi KS, Chen BJ, Kunjo SO, Topalidou I, Lehrbach N. 2026. Lysine deficiency within a conserved lysine desert is critical for EEL-1/HUWE1 to support ubiquitin proteasome system function. PLoS Genet. 22: e1012273. 657.","pubmedId":"42574471","doi":"10.1371/journal.pgen.1012273"},{"reference":"Hefel A, Smolikove S. 2019. Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline. G3 (Bethesda). 9: 1933-1943. 658.","pubmedId":"30992318","doi":"10.1534/g3.119.400162"},{"reference":"He S, Cuentas Condori A, Miller DM. 2019. NATF (Native and Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. Genetics. 212: 387-395. 659.","pubmedId":"30952669","doi":"10.1534/genetics.119.302063"},{"reference":"Feng S, Varshney A, Coto Villa D, Modavi C, Kohler J, Farah F, et al., Huang B. 2019. Bright split red fluorescent proteins for the visualization of endogenous proteins and synapses. Commun Biol. 2: 344. 660.","pubmedId":"31552297","doi":"10.1038/s42003-019-0589-x"},{"reference":"Noma K, Goncharov A, Ellisman MH, Jin Y. 2017. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 6 661.","pubmedId":"28767038","doi":"10.7554/eLife.26376"}],"title":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans.
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1791079695573"}]},{"id":"c3374702-29c5-4bf9-bfdf-0163774cb1c7","decision":"accept","abstract":"Understanding protein function requires tools to visualize and manipulate proteins in vivo. NanoTags, short epitope tags that are recognized by single-chain antibodies, are an emerging method for versatile in vivo labelling and manipulation of endogenous proteins. The short (13 amino acid) ALFA tag has been shown to allow labelling of endogenous proteins in several model systems, including C. elegans. Here we describe the generation and validation of transgenes to facilitate global and tissue-specific visualization of ALFA-tagged endogenous proteins in C. elegans. We propose a modular NanoTag system as a powerful approach for investigating protein functions in vivo in C. elegans.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["writing_reviewEditing","methodology","investigation"],"email":"etopalid@fredhutch.org","firstName":"Irini","lastName":"Topalidou","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-1115-4251"},{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["conceptualization","fundingAcquisition","writing_originalDraft","investigation","methodology","visualization"],"email":"nlehrbach@fredhutch.org","firstName":"Nicolas","lastName":"Lehrbach","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7342-4136"}],"awards":[{"awardId":"R35 GM142728","funderName":"National Institutes of Health (United States)","awardRecipient":"Nicolas Lehrbach"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/36598ea216159192df6076b5527de08e.jpg"},"imageCaption":"(A) Fluorescence images showing expression of NbALFA::GFP and labelling of ALFA-tagged endogenous proteins. Images of WT animals are included to show levels and localization of NbALFA::GFP in the absence of an ALFA-tagged target protein. ALFA-tagged nuclear proteins HIS-72 and LMN-1 cause increased nuclear localization of NbALFA::GFP. Expression of UNC-54 is restricted to the body wall muscle, so introduction of the tag does not alter NbALFA::GFP localization in non-muscle tissues (see panel (D) for a higher magnification image showing NbALFA::GFP-mediated labelling of UNC-54::ALFA in muscle cells).
(B) Fluorescence images showing expression of NbALFA::tagRFP and labelling of ALFA-tagged nuclear lamin LMN-1.
(C) High magnification fluorescence images showing labelling of ALFA-tagged HIS-72 and LMN-1 using NbALFA::GFP.
(D) High magnification image showing labelling of ALFA-tagged UNC-54 in the body wall muscle using NbALFA::GFP. An image of an animal in which UNC-54 is directly tagged with GFP is shown for comparison. NbALFA labelling is not as bright and is not accompanied by disruption of muscle fibers.
(E) Fluorescence images showing tissue-specific labelling of ALFA-tagged HIS-72 with NbALFA::GFP.
","imageTitle":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans
","methods":"
C. elegans husbandry.
C. elegans were maintained on standard nematode growth media (NGM) at 20°C and fed E. coli OP50. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). The following strains were used in this study are listed below.
Strain name | Genotype | Reference |
(Yanagi et al., 2026) | ||
unc-119(kst33) III; nicSi749 [rpl-28p::NbALFA::tagRFP::tbb-2] | (Yanagi et al., 2026) | |
lmn-1(nic1723[ALFA]) I; unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
his-72(nic1725[ALFA]) III unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
unc-54(nic1731[ALFA]) I; unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
lmn-1(nic1724[ALFA]) I; unc-119(kst33) III; nicSi749[rpl-28p::NbALFA::tagRFP::tbb-2] | this study | |
this study | ||
this study | ||
this study | ||
this study | ||
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi813[myo-3p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi808[sng-1p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi823[vha-6p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi832[col-10p::NbALFA::GFP::tbb-2] | this study | |
(Arribere et al., 2016) |
Plasmid constructs and generation of transgenic animals.
All cloning was carried out using the NEBuilder HiFi DNA Assembly kit (New England Biolabs #E2621). The sequence encoding NbALFA was codon-optimized for expression in C. elegans using the transgenebuilder tool (Beta Version; https://www.wormbuilder.org/transgenebuilder/) and synthesized to include a single intron (from the rps-0 gene) and a C-terminal in-frame linker sequence (STSGGSGGTGGSS). Gene synthesis was carried out by Twist Biosciences. Gibson assembly was used to generate plasmids in which NbALFA fusion proteins are expressed under control of various promoters: rpl-28 promoter (ubiquitous expression, 605 bp immediately upstream of the rpl-28 ORF), myo-3 promoter (body wall muscle expression, 2139 bp immediately upstream of the myo-3 ORF), sng-1 promoter (neuronal expression, 2080 bp immediately upstream of the sng-1 ORF), vha-6 promoter (intestinal expression, 934 bp immediately upstream of the vha-6 ORF), col-10 promoter (hypodermal expression, 1126 bp immediately upstream of the col-10 ORF). All constructs are followed by the tbb-2 3'UTR (376 bp immediately downstream of the tbb-2 stop codon). These constructs were inserted into the pNL43 backbone, which contains a cbr-unc-119 rescue cassette (Lehrbach & Ruvkun, 2016). The plasmids were used to generate transgenic (miniMos insertion) animals harboring single-copy transgenes (Frokjaer-Jensen et al., 2014). We did not systematically determine the integration sites of the miniMos insertions. We assigned linkage of one of the insertions (nicSi744), based on segregation away from markers on chromosome V. Plasmids used in this study are listed below.
Plasmid | Description |
pNL549 | |
pNL559 | |
pNL594 | |
pNL595 | |
pNL596 | |
pNL598 |
Gene editing by CRISPR/Cas9.
CRISPR/Cas9 genome editing was carried out through microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1081058, #1072532, and custom crRNA) along with single-stranded oligonucleotides (IDT) as homology-directed repair (HDR) templates (Ghanta & Mello, 2020; Paix et al., 2015). All CRISPR edits were identified by diagnostic PCR and confirmed by sequencing. Guide RNAs and HDR oligos used in this study are listed below.
Edit created | Guide RNA sequence | HDR oligo sequence |
ALFA::his-72 | GGTACGAGCCATTGTTGTTC | AttctcaatttccagaacaacaATGCCAT CCCGGCTCGAGGAAGAGCTCCGTCGACGT CTCACCGAGCCAGCTCGTACCAAGCAAAC CGCTCGTAAATCC |
ALFA::lmn-1 | AGAAAAATGTCATCTCGTAA
| taactcttcagaaagcagcgagaaaaATG CCATCCCGGCTCGAGGAAGAGCTCCGTCG ACGTCTCACCGAGCCATCATCTCGTAAAG GTACTCGTAGTTCT |
unc-54::ALFA | TAATTGGACTTAGAAGTCAG
| CCATCTCGCGCCCGTGCCTCTGACTTCCC ATCCCGGCTCGAGGAAGAGCTCCGTCGAC GTCTCACCGAGTAAgtccaattactcttc aacatccct |
Microscopy
Fluorescence images were collected on a Leica M165FC equipped with a 910 Leica K5 sCMOS camera using LAS X software (version 3.7.5.24914) or on a Zeiss AxioImager Z1 equipped with an Axiocam 705 CMOS camera and using ZEN software (version 3.3.89.0003). Worms were immobilized using sodium azide and mounted on 2% agarose pads. All images were processed and analyzed using ImageJ/Fiji software (version 2.16.0/1.54p).
","reagents":"","patternDescription":"Studies of protein function rely on labelling tools to visualize or manipulate proteins in vivo. In genetically tractable model organisms such as C. elegans, CRISPR-mediated gene editing can be used to knock-in fluorescent or other functionalized tags to endogenous proteins for visualization and/or manipulation (Artan et al., 2021; Ghanta & Mello, 2020; Kurashina & Mizumoto, 2023; Schwartz et al., 2021; Zhang et al., 2015). However, directly tagging proteins of interest is not ideal for all applications. Tags such as GFP or other fluorescent proteins are valuable for protein visualization by live microscopy. However, their relatively large size can interfere with protein structure or function. Further, directly tagging endogenous loci causes labelling of the protein of interest in all tissues where it is expressed, which can complicate analysis of tissue-specific protein functions. Finally, tagging a single protein with multiple fluorescent or other functional tags requires the generation and validation of a new edited line for each tag. Expanding the repertoire and modularity of tools for endogenous protein labelling would therefore accelerate research into protein function in vivo.
NanoTags, short epitope tags that are bound at high affinity by single-chain antibodies (nanobodies, or Nbs), offer several advantages for in vivo labelling of endogenous proteins (Cheloha et al., 2020). NanoTag epitopes are typically small (~10-15 amino acids), reducing the possibility that the tag interferes with protein folding or function. Nanobodies can readily be expressed as recombinant proteins via transgenes, a strategy that has been used to label tagged proteins in various experimental systems (Igreja et al., 2022; Kim et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Virant et al., 2018; Wang et al., 2025; Xu et al., 2022; Zeghal et al., 2023). The 13 amino acid ALFA-tag is recognized with high specificity and affinity by an ALFA-specific nanobody (NbALFA) (Gotzke et al., 2019). CRISPR/Cas9 mediated knock-in of an ALFA-tag allows detection or labelling of endogenous proteins with NbALFA (Igreja et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Wang et al., 2025; Xu et al., 2022). Transgenic strains that express NbALFA fusions in C. elegans germline have been produced by two labs (NbALFA::mKate2, Quintin et al., 2025 and NbALFA::HaloTag, van der Salm et al., 2026) and shown to enable live imaging of ALFA-tagged endogenous proteins in the germline and embryos. Here, we confirm the broad utility of NbALFA for labelling endogenous proteins, by using transgenes to drive whole-animal and tissue-specific expression of NbALFA fusion proteins.
We generated constructs in which an NbALFA::GFP or an NbALFA::tagRFP fusion is controlled by the promoter of the ubiquitously expressed rpl-28 gene. We then generated single copy insertion lines for each construct using miniMos (Frokjaer-Jensen et al., 2014). We observed diffuse nuclear and cytosolic fluorescence in NbALFA::GFP and NbALFA::tagRFP transgenic animals. To test the ability of the NbALFA fusions to recognize ALFA-tagged endogenous proteins, we used CRISPR/Cas9 to ALFA-tag highly expressed proteins with easily detectable localization patterns: his-72, encoding a histone H3.3, which is expressed in all tissues and localizes to chromatin in the nucleus; lmn-1, encoding a nuclear lamin; and unc-54, which encodes myosin heavy chain (MHC B) expressed specifically in body wall muscle. In each case, we observed localization patterns consistent with specific labelling of the endogenously tagged protein (Fig. 1A-D).
We noticed a slight increase in the overall fluorescence of NbALFA::GFP and NbALFA::tagRFP following ALFA-tagging of abundant endogenous proteins (Fig. 1A-C). This appears to be a specific effect of the interaction between the NbALFA fusion and its target protein: UNC-54 is expressed specifically in muscle, and we did not observe a change in NbALFA::GFP levels in non-muscle cells of unc-54::ALFA animals (Fig. 1A). These observations suggest that NbALFA fusion proteins are unstable when they are not bound to a target ALFA-tagged protein. A similar effect has been observed in mammalian cells, suggesting that NbALFA is generally unstable in animal cells unless bound to an ALFA-tagged target protein (Wang et al., 2025).
Labelling of endogenous proteins with fluorescent tags can, in some cases, interfere with the function of the tagged protein. GFP-tagging of LMN-1 and of the muscle myosin UNC-54 both cause sluggish locomotion, suggesting impaired function of the tagged protein (Arribere et al., 2016; Gregory et al., 2023). However, we did not observe any obvious change in locomotion of animals in which LMN-1::ALFA or UNC-54::ALFA is labelled by NbALFA::GFP. The organization of muscle filaments appears disrupted in unc-54::gfp animals but not in animals in which UNC-54::ALFA is labelled via NbALFA::GFP (Fig. 1D). These observations support that ALFA-tagging provides a means to tag and visualize the localization of endogenous proteins by live imaging without the drawbacks of direct addition of a bulky fluorescent tag that can interfere with protein structure or function.
Finally, we sought to test the possibility of using NbALFA fusion proteins to label endogenous proteins in a tissue-specific manner. We generated transgenic animals expressing NbALFA::GFP under the control of several tissue specific promoters and tested their ability to label HIS-72::ALFA in the corresponding tissues. In each case, we detected the expected increase in nuclear localization of NbALFA::GFP, indicating tissue-specific labelling of histone H3 (Fig. 1E). In addition to labelling of HIS-72 in the nucleus, we observed additional cytosolic signal in some tissues, which was especially pronounced with hypodermal col-10p::NbALFA::GFP. It is possible that strong expression of tissue-specific promoters leads to increased background signal from NbALFA::GFP that is not bound to the ALFA-tagged target.
Here, we have generated transgenic strains expressing NbALFA fused to fluorescent proteins to facilitate global and tissue-specific fluorescent labelling using NanoTagging in C. elegans. Our work provides new ways to achieve labelling in entire animals or in specific somatic tissues, which complements tools for labelling ALFA-tagged proteins in C. elegans already generated by other groups (Quintin et al., 2025; van der Salm et al., 2026). Importantly, van der Salm and colleagues' work demonstrates the use of orthogonal labelling strategies in combination with the ALFA tag for simultaneous live imaging of multiple proteins and discusses the advantages of indirect labelling in detail (van der Salm et al., 2026). We note that the transgenes we generated are randomly inserted into the genome via miniMos and we have not systematically determined their integration sites. Insertions of similar transgenes for tissue-specific NbALFA labelling at defined safe-harbor loci would improve their utility.
Because the short ALFA-tag is straightforward to introduce via CRISPR/Cas9, these tools can be used to quickly generate strains in which any protein of interest is labelled. We tested this system for labelling highly abundant proteins but have not yet carefully evaluated the extent of background signal (i.e. we do not know what fraction of fluorescent signal is derived from NbALFA::GFP/tagRFP molecules that are not bound to their target). This caveat of the ALFA-tagging approach contrasts with split-GFP labelling, in which the fluorophore is reconstituted upon binding to the target protein, yielding minimal background signal (Feng et al., 2019; He et al., 2019; Hefel & Smolikove, 2019; Noma et al., 2017). ALFA-tagging may be an attractive alternative to split-GFP in cases where background signal is not a concern, or where maximizing signal is important, since reconstituted split-GFP is much dimmer than intact GFP (Feng et al., 2019). Given the potential for background signal to complicate analysis, it will be important to test the ALFA system for detection of less abundant proteins and to explore strategies for increasing labelling specificity, perhaps by using NbALFA variants whose stability or fluorescence of the attached fluorophore is dependent on binding to an ALFA-tagged target (Barykina et al., 2026; Wang et al., 2025). Labelling efficiency could also be enhanced by incorporating multiple tags in tandem to a target protein, as van der Salm and colleagues demonstrate using the SunTag System.
Improving and expanding the NanoTag toolkit will enable new applications. For example, cell-type specific promoters would allow labelling of endogenous proteins with greater anatomical specificity. Fusion of NbALFA to other functional partners could be used to achieve various tissue-specific manipulations. Potential applications could include tissue-specific proximity labelling, manipulation of protein localization, protein-protein interactions, or stability. In conclusion, these tools and those reported by others (Igreja et al., 2022; Quintin et al., 2025; van der Salm et al., 2026), support the usefulness of NanoTags in C. elegans. We hope that continued development of NanoTagging tools for C. elegans will enable new approaches to investigating protein function in vivo.
","references":[{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics. 216: 643-650. 217.","pubmedId":"32963112","doi":"10.1534/genetics.120.303564"},{"reference":"Lehrbach NJ, Ruvkun G. 2016. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife. 5: e17721. 5.","pubmedId":"27528192","doi":"10.7554/eLife.17721"},{"reference":"Frokjaer Jensen C, Davis MW, Sarov M, Taylor J, Flibotte S, La Bella M, et al., Jorgensen EM. 2014. Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods. 11: 529-34. 282.","pubmedId":"24820376","doi":"10.1038/nmeth.2889"},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 201: 47-54. 283.","pubmedId":"26187122","doi":"10.1534/genetics.115.179382"},{"reference":"Gotzke H, Kilisch M, Martinez Carranza M, Sograte Idrissi S, Rajavel A, Schlichthaerle T, et al., Frey S. 2019. The ALFA-tag is a highly versatile tool for nanobody-based bioscience applications. Nat Commun. 10: 4403. 410.","pubmedId":"31562305","doi":"10.1038/s41467-019-12301-7"},{"reference":"Artan M, Barratt S, Flynn SM, Begum F, Skehel M, Nicolas A, De Bono M. 2021. Interactome analysis of Caenorhabditis elegans synapses by TurboID-based proximity labeling. J Biol Chem. 297: 101094. 455.","pubmedId":"34416233","doi":"10.1016/j.jbc.2021.101094"},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development. 142: 4374-84. 518.","pubmedId":"26552885","doi":"10.1242/dev.129635"},{"reference":"Kurashina M, Mizumoto K. 2023. Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. STAR Protoc. 4: 102028. 527.","pubmedId":"36640369","doi":"10.1016/j.xpro.2022.102028"},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet. 17: e1009755. 529.","pubmedId":"34748534","doi":"10.1371/journal.pgen.1009755"},{"reference":"Cheloha RW, Harmand TJ, Wijne C, Schwartz TU, Ploegh HL. 2020. Exploring cellular biochemistry with nanobodies. J Biol Chem. 295: 15307-15327. 530.","pubmedId":"32868455","doi":"10.1074/jbc.REV120.012960"},{"reference":"Quintin S, Saad MI, Amann G, Reymann AC. 2025. In vivo detection of ALFA-tagged proteins in C. elegans with a transgenic fluorescent nanobody. MicroPubl Biol. 2025 531.","pubmedId":"40321834","doi":"10.17912/micropub.biology.001542"},{"reference":"Igreja C, Loschko T, Schafer A, Sharma R, Quiobe SP, Aloshy E, Witte H, Sommer RJ. 2022. Application of ALFA-Tagging in the Nematode Model Organisms Caenorhabditis elegans and Pristionchus pacificus. Cells. 11 532.","pubmedId":"36497133","doi":"10.3390/cells11233875"},{"reference":"Kim AR, Xu J, Cheloha R, Mohr SE, Zirin J, Ploegh HL, Perrimon N. 2022. NanoTag Nanobody Tools for Drosophila In Vitro and In Vivo Studies. Curr Protoc. 2: e628. 533.","pubmedId":"36571722","doi":"10.1002/cpz1.628"},{"reference":"Xu J, Kim AR, Cheloha RW, Fischer FA, Li JSS, Feng Y, et al., Perrimon N. 2022. Protein visualization and manipulation in Drosophila through the use of epitope tags recognized by nanobodies. Elife. 11 534.","pubmedId":"35076390","doi":"10.7554/eLife.74326"},{"reference":"Wang Z, Hu F, Xue F, He W, Yuan L, Xu P. 2025. ALFA nanobody-guided endogenous labeling. Nat Chem Biol 535.","pubmedId":"40883491","doi":"10.1038/s41589-025-02019-7"},{"reference":"Van Der Salm E, Schroeder MH, Steller LB, Miller SI, Scheper A, Nowee G, Griffin EE, Ruijtenberg S. 2026. Epitope-based labeling for improved live-imaging of endogenous proteins in C. elegans. G3 (Bethesda) 650.","pubmedId":"42671252","doi":"10.1093/g3journal/jkag212"},{"reference":"Neveu J, Spielmann J, Fanara S, Delesalle C, Cantaloube S, Vert G. 2025. Broad application of plant protein tagging with ALFA tag for nanobody-based imaging and biochemical approaches. bioRxiv: 2025.03.19.644120. 651.","pubmedId":"","doi":"10.1101/2025.03.19.644120"},{"reference":"Gregory EF, Ragle JM, Ward JD, Starr DA. 2023. Split-GFP lamin as a tool for studying C. elegans LMN-1 dynamics in vivo. MicroPubl Biol. 2023 652.","pubmedId":"38152058","doi":"10.17912/micropub.biology.001022"},{"reference":"Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. 2016. Translation readthrough mitigation. Nature. 534: 719-23. 653.","pubmedId":"27281202","doi":"10.1038/nature18308"},{"reference":"Barykina NV, Carey EM, Oliinyk OS, Mendonca Gomes JM, De Oliveira S, Nimmerjahn A, Verkhusha VV. 2026. Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labeling and functional imaging. Nat Methods. 23: 972-985. 654.","pubmedId":"42020773","doi":"10.1038/s41592-026-03056-3"},{"reference":"Virant D, Traenkle B, Maier J, Kaiser PD, Bodenhofer M, Schmees C, et al., Rothbauer U. 2018. A peptide tag-specific nanobody enables high-quality labeling for dSTORM imaging. Nat Commun. 9: 930. 655.","pubmedId":"29500346","doi":"10.1038/s41467-018-03191-2"},{"reference":"Zeghal M, Matte K, Venes A, Patel S, Laroche G, Sarvan S, et al., Giguere PM. 2023. Development of a V5-tag-directed nanobody and its implementation as an intracellular biosensor of GPCR signaling. J Biol Chem. 299: 105107. 656.","pubmedId":"37517699","doi":"10.1016/j.jbc.2023.105107"},{"reference":"Yanagi KS, Chen BJ, Kunjo SO, Topalidou I, Lehrbach N. 2026. Lysine deficiency within a conserved lysine desert is critical for EEL-1/HUWE1 to support ubiquitin proteasome system function. PLoS Genet. 22: e1012273. 657.","pubmedId":"42574471","doi":"10.1371/journal.pgen.1012273"},{"reference":"Hefel A, Smolikove S. 2019. Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline. G3 (Bethesda). 9: 1933-1943. 658.","pubmedId":"30992318","doi":"10.1534/g3.119.400162"},{"reference":"He S, Cuentas Condori A, Miller DM. 2019. NATF (Native and Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. Genetics. 212: 387-395. 659.","pubmedId":"30952669","doi":"10.1534/genetics.119.302063"},{"reference":"Feng S, Varshney A, Coto Villa D, Modavi C, Kohler J, Farah F, et al., Huang B. 2019. Bright split red fluorescent proteins for the visualization of endogenous proteins and synapses. Commun Biol. 2: 344. 660.","pubmedId":"31552297","doi":"10.1038/s42003-019-0589-x"},{"reference":"Noma K, Goncharov A, Ellisman MH, Jin Y. 2017. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 6 661.","pubmedId":"28767038","doi":"10.7554/eLife.26376"}],"title":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans.
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1791869118712"}]},{"id":"c5c0dbee-3ca5-4f81-a01e-a44c319af5c8","decision":"accept","abstract":"Understanding protein function requires tools to visualize and manipulate proteins in vivo. NanoTags, short epitope tags that are recognized by single-chain antibodies, are an emerging method for versatile in vivo labelling and manipulation of endogenous proteins. The short (13 amino acid) ALFA tag has been shown to allow labelling of endogenous proteins in several model systems, including C. elegans. Here we describe the generation and validation of transgenes to facilitate global and tissue-specific visualization of ALFA-tagged endogenous proteins in C. elegans. We propose a modular NanoTag system as a powerful approach for investigating protein functions in vivo in C. elegans.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["writing_reviewEditing","methodology","investigation"],"email":"etopalid@fredhutch.org","firstName":"Irini","lastName":"Topalidou","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-1115-4251"},{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["conceptualization","fundingAcquisition","writing_originalDraft","investigation","methodology","visualization"],"email":"nlehrbach@fredhutch.org","firstName":"Nicolas","lastName":"Lehrbach","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7342-4136"}],"awards":[{"awardId":"R35 GM142728","funderName":"National Institutes of Health (United States)","awardRecipient":"Nicolas Lehrbach"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/36598ea216159192df6076b5527de08e.jpg"},"imageCaption":"(A) Fluorescence images showing expression of NbALFA::GFP and labelling of ALFA-tagged endogenous proteins. Images of WT animals are included to show levels and localization of NbALFA::GFP in the absence of an ALFA-tagged target protein. ALFA-tagged nuclear proteins HIS-72 and LMN-1 cause increased nuclear localization of NbALFA::GFP. Expression of UNC-54 is restricted to the body wall muscle, so introduction of the tag does not alter NbALFA::GFP localization in non-muscle tissues (see panel (D) for a higher magnification image showing NbALFA::GFP-mediated labelling of UNC-54::ALFA in muscle cells).
(B) Fluorescence images showing expression of NbALFA::tagRFP and labelling of ALFA-tagged nuclear lamin LMN-1.
(C) High magnification fluorescence images showing labelling of ALFA-tagged HIS-72 and LMN-1 using NbALFA::GFP.
(D) High magnification image showing labelling of ALFA-tagged UNC-54 in the body wall muscle using NbALFA::GFP. An image of an animal in which UNC-54 is directly tagged with GFP is shown for comparison. NbALFA labelling is not as bright and is not accompanied by disruption of muscle fibers.
(E) Fluorescence images showing tissue-specific labelling of ALFA-tagged HIS-72 with NbALFA::GFP.
","imageTitle":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans
","methods":"
C. elegans husbandry.
C. elegans were maintained on standard nematode growth media (NGM) at 20°C and fed E. coli OP50. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). The following strains were used in this study are listed below.
Strain name | Genotype | Reference |
(Yanagi et al., 2026) | ||
unc-119(kst33) III; nicSi749 [rpl-28p::NbALFA::tagRFP::tbb-2] | (Yanagi et al., 2026) | |
lmn-1(nic1723[ALFA]) I; unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
his-72(nic1725[ALFA]) III unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
unc-54(nic1731[ALFA]) I; unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
lmn-1(nic1724[ALFA]) I; unc-119(kst33) III; nicSi749[rpl-28p::NbALFA::tagRFP::tbb-2] | this study | |
NJL5334 | this study | |
this study | ||
this study | ||
NJL5392 | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi813[myo-3p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi808[sng-1p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi823[vha-6p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi832[col-10p::NbALFA::GFP::tbb-2] | this study | |
(Arribere et al., 2016) |
Plasmid constructs and generation of transgenic animals.
All cloning was carried out using the NEBuilder HiFi DNA Assembly kit (New England Biolabs #E2621). The sequence encoding NbALFA was codon-optimized for expression in C. elegans using the transgenebuilder tool (Beta Version; https://www.wormbuilder.org/transgenebuilder/) and synthesized to include a single intron (from the rps-0 gene) and a C-terminal in-frame linker sequence (STSGGSGGTGGSS). Gene synthesis was carried out by Twist Biosciences. Gibson assembly was used to generate plasmids in which NbALFA fusion proteins are expressed under control of various promoters: rpl-28 promoter (ubiquitous expression, 605 bp immediately upstream of the rpl-28 ORF), myo-3 promoter (body wall muscle expression, 2139 bp immediately upstream of the myo-3 ORF), sng-1 promoter (neuronal expression, 2080 bp immediately upstream of the sng-1 ORF), vha-6 promoter (intestinal expression, 934 bp immediately upstream of the vha-6 ORF), col-10 promoter (hypodermal expression, 1126 bp immediately upstream of the col-10 ORF). All constructs are followed by the tbb-2 3'UTR (376 bp immediately downstream of the tbb-2 stop codon). These constructs were inserted into the pNL43 backbone, which contains a cbr-unc-119 rescue cassette (Lehrbach & Ruvkun, 2016). The plasmids were used to generate transgenic (miniMos insertion) animals harboring single-copy transgenes (Frokjaer-Jensen et al., 2014). We did not systematically determine the integration sites of the miniMos insertions. We assigned linkage of one of the insertions (nicSi744), based on segregation away from markers on chromosome V. Plasmids used in this study are listed below.
Plasmid | Description |
pNL549 | |
pNL559 | |
pNL594 | |
pNL595 | |
pNL596 | |
pNL598 |
Gene editing by CRISPR/Cas9.
CRISPR/Cas9 genome editing was carried out through microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1081058, #1072532, and custom crRNA) along with single-stranded oligonucleotides (IDT) as homology-directed repair (HDR) templates (Ghanta & Mello, 2020; Paix et al., 2015). All CRISPR edits were identified by diagnostic PCR and confirmed by sequencing. Guide RNAs and HDR oligos used in this study are listed below.
Edit created | Guide RNA sequence | HDR oligo sequence |
ALFA::his-72 | GGTACGAGCCATTGTTGTTC | AttctcaatttccagaacaacaATGCCAT CCCGGCTCGAGGAAGAGCTCCGTCGACGT CTCACCGAGCCAGCTCGTACCAAGCAAAC CGCTCGTAAATCC |
ALFA::lmn-1 | AGAAAAATGTCATCTCGTAA
| taactcttcagaaagcagcgagaaaaATG CCATCCCGGCTCGAGGAAGAGCTCCGTCG ACGTCTCACCGAGCCATCATCTCGTAAAG GTACTCGTAGTTCT |
unc-54::ALFA | TAATTGGACTTAGAAGTCAG
| CCATCTCGCGCCCGTGCCTCTGACTTCCC ATCCCGGCTCGAGGAAGAGCTCCGTCGAC GTCTCACCGAGTAAgtccaattactcttc aacatccct |
Microscopy
Fluorescence images were collected on a Leica M165FC equipped with a 910 Leica K5 sCMOS camera using LAS X software (version 3.7.5.24914) or on a Zeiss AxioImager Z1 equipped with an Axiocam 705 CMOS camera and using ZEN software (version 3.3.89.0003). Worms were immobilized using sodium azide and mounted on 2% agarose pads. All images were processed and analyzed using ImageJ/Fiji software (version 2.16.0/1.54p).
","reagents":"","patternDescription":"Studies of protein function rely on labelling tools to visualize or manipulate proteins in vivo. In genetically tractable model organisms such as C. elegans, CRISPR-mediated gene editing can be used to knock-in fluorescent or other functionalized tags to endogenous proteins for visualization and/or manipulation (Artan et al., 2021; Ghanta & Mello, 2020; Kurashina & Mizumoto, 2023; Schwartz et al., 2021; Zhang et al., 2015). However, directly tagging proteins of interest is not ideal for all applications. Tags such as GFP or other fluorescent proteins are valuable for protein visualization by live microscopy. However, their relatively large size can interfere with protein structure or function. Further, directly tagging endogenous loci causes labelling of the protein of interest in all tissues where it is expressed, which can complicate analysis of tissue-specific protein functions. Finally, tagging a single protein with multiple fluorescent or other functional tags requires the generation and validation of a new edited line for each tag. Expanding the repertoire and modularity of tools for endogenous protein labelling would therefore accelerate research into protein function in vivo.
NanoTags, short epitope tags that are bound at high affinity by single-chain antibodies (nanobodies, or Nbs), offer several advantages for in vivo labelling of endogenous proteins (Cheloha et al., 2020). NanoTag epitopes are typically small (~10-15 amino acids), reducing the possibility that the tag interferes with protein folding or function. Nanobodies can readily be expressed as recombinant proteins via transgenes, a strategy that has been used to label tagged proteins in various experimental systems (Igreja et al., 2022; Kim et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Virant et al., 2018; Wang et al., 2025; Xu et al., 2022; Zeghal et al., 2023). The 13 amino acid ALFA-tag is recognized with high specificity and affinity by an ALFA-specific nanobody (NbALFA) (Gotzke et al., 2019). CRISPR/Cas9 mediated knock-in of an ALFA-tag allows detection or labelling of endogenous proteins with NbALFA (Igreja et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Wang et al., 2025; Xu et al., 2022). Transgenic strains that express NbALFA fusions in C. elegans germline have been produced by two labs (NbALFA::mKate2, Quintin et al., 2025 and NbALFA::HaloTag, van der Salm et al., 2026) and shown to enable live imaging of ALFA-tagged endogenous proteins in the germline and embryos. Here, we confirm the broad utility of NbALFA for labelling endogenous proteins, by using transgenes to drive whole-animal and tissue-specific expression of NbALFA fusion proteins.
We generated constructs in which an NbALFA::GFP or an NbALFA::tagRFP fusion is controlled by the promoter of the ubiquitously expressed rpl-28 gene. We then generated single copy insertion lines for each construct using miniMos (Frokjaer-Jensen et al., 2014). We observed diffuse nuclear and cytosolic fluorescence in NbALFA::GFP and NbALFA::tagRFP transgenic animals. To test the ability of the NbALFA fusions to recognize ALFA-tagged endogenous proteins, we used CRISPR/Cas9 to ALFA-tag highly expressed proteins with easily detectable localization patterns: his-72, encoding a histone H3.3, which is expressed in all tissues and localizes to chromatin in the nucleus; lmn-1, encoding a nuclear lamin; and unc-54, which encodes myosin heavy chain (MHC B) expressed specifically in body wall muscle. In each case, we observed localization patterns consistent with specific labelling of the endogenously tagged protein (Fig. 1A-D).
We noticed a slight increase in the overall fluorescence of NbALFA::GFP and NbALFA::tagRFP following ALFA-tagging of abundant endogenous proteins (Fig. 1A-C). This appears to be a specific effect of the interaction between the NbALFA fusion and its target protein: UNC-54 is expressed specifically in muscle, and we did not observe a change in NbALFA::GFP levels in non-muscle cells of unc-54::ALFA animals (Fig. 1A). These observations suggest that NbALFA fusion proteins are unstable when they are not bound to a target ALFA-tagged protein. A similar effect has been observed in mammalian cells, suggesting that NbALFA is generally unstable in animal cells unless bound to an ALFA-tagged target protein (Wang et al., 2025).
Labelling of endogenous proteins with fluorescent tags can, in some cases, interfere with the function of the tagged protein. GFP-tagging of LMN-1 and of the muscle myosin UNC-54 both cause sluggish locomotion, suggesting impaired function of the tagged protein (Arribere et al., 2016; Gregory et al., 2023). However, we did not observe any obvious change in locomotion of animals in which LMN-1::ALFA or UNC-54::ALFA is labelled by NbALFA::GFP. The organization of muscle filaments appears disrupted in unc-54::gfp animals but not in animals in which UNC-54::ALFA is labelled via NbALFA::GFP (Fig. 1D). These observations support that ALFA-tagging provides a means to tag and visualize the localization of endogenous proteins by live imaging without the drawbacks of direct addition of a bulky fluorescent tag that can interfere with protein structure or function.
Finally, we sought to test the possibility of using NbALFA fusion proteins to label endogenous proteins in a tissue-specific manner. We generated transgenic animals expressing NbALFA::GFP under the control of several tissue specific promoters and tested their ability to label HIS-72::ALFA in the corresponding tissues. In each case, we detected the expected increase in nuclear localization of NbALFA::GFP, indicating tissue-specific labelling of histone H3 (Fig. 1E). In addition to labelling of HIS-72 in the nucleus, we observed additional cytosolic signal in some tissues, which was especially pronounced with hypodermal col-10p::NbALFA::GFP. It is possible that strong expression of tissue-specific promoters leads to increased background signal from NbALFA::GFP that is not bound to the ALFA-tagged target.
Here, we have generated transgenic strains expressing NbALFA fused to fluorescent proteins to facilitate global and tissue-specific fluorescent labelling using NanoTagging in C. elegans. Our work provides new ways to achieve labelling in entire animals or in specific somatic tissues, which complements tools for labelling ALFA-tagged proteins in C. elegans already generated by other groups (Quintin et al., 2025; van der Salm et al., 2026). Importantly, van der Salm and colleagues' work demonstrates the use of orthogonal labelling strategies in combination with the ALFA tag for simultaneous live imaging of multiple proteins and discusses the advantages of indirect labelling in detail (van der Salm et al., 2026). We note that the transgenes we generated are randomly inserted into the genome via miniMos and we have not systematically determined their integration sites. Insertions of similar transgenes for tissue-specific NbALFA labelling at defined safe-harbor loci would improve their utility.
Because the short ALFA-tag is straightforward to introduce via CRISPR/Cas9, these tools can be used to quickly generate strains in which any protein of interest is labelled. We tested this system for labelling highly abundant proteins but have not yet carefully evaluated the extent of background signal (i.e. we do not know what fraction of fluorescent signal is derived from NbALFA::GFP/tagRFP molecules that are not bound to their target). This caveat of the ALFA-tagging approach contrasts with split-GFP labelling, in which the fluorophore is reconstituted upon binding to the target protein, yielding minimal background signal (Feng et al., 2019; He et al., 2019; Hefel & Smolikove, 2019; Noma et al., 2017). ALFA-tagging may be an attractive alternative to split-GFP in cases where background signal is not a concern, or where maximizing signal is important, since reconstituted split-GFP is much dimmer than intact GFP (Feng et al., 2019). Given the potential for background signal to complicate analysis, it will be important to test the ALFA system for detection of less abundant proteins and to explore strategies for increasing labelling specificity, perhaps by using NbALFA variants whose stability or fluorescence of the attached fluorophore is dependent on binding to an ALFA-tagged target (Barykina et al., 2026; Wang et al., 2025). Labelling efficiency could also be enhanced by incorporating multiple tags in tandem to a target protein, as van der Salm and colleagues demonstrate using the SunTag System.
Improving and expanding the NanoTag toolkit will enable new applications. For example, cell-type specific promoters would allow labelling of endogenous proteins with greater anatomical specificity. Fusion of NbALFA to other functional partners could be used to achieve various tissue-specific manipulations. Potential applications could include tissue-specific proximity labelling, manipulation of protein localization, protein-protein interactions, or stability. In conclusion, these tools and those reported by others (Igreja et al., 2022; Quintin et al., 2025; van der Salm et al., 2026), support the usefulness of NanoTags in C. elegans. We hope that continued development of NanoTagging tools for C. elegans will enable new approaches to investigating protein function in vivo.
","references":[{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics. 216: 643-650. 217.","pubmedId":"32963112","doi":"10.1534/genetics.120.303564"},{"reference":"Lehrbach NJ, Ruvkun G. 2016. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife. 5: e17721. 5.","pubmedId":"27528192","doi":"10.7554/eLife.17721"},{"reference":"Frokjaer Jensen C, Davis MW, Sarov M, Taylor J, Flibotte S, La Bella M, et al., Jorgensen EM. 2014. Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods. 11: 529-34. 282.","pubmedId":"24820376","doi":"10.1038/nmeth.2889"},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 201: 47-54. 283.","pubmedId":"26187122","doi":"10.1534/genetics.115.179382"},{"reference":"Gotzke H, Kilisch M, Martinez Carranza M, Sograte Idrissi S, Rajavel A, Schlichthaerle T, et al., Frey S. 2019. The ALFA-tag is a highly versatile tool for nanobody-based bioscience applications. Nat Commun. 10: 4403. 410.","pubmedId":"31562305","doi":"10.1038/s41467-019-12301-7"},{"reference":"Artan M, Barratt S, Flynn SM, Begum F, Skehel M, Nicolas A, De Bono M. 2021. Interactome analysis of Caenorhabditis elegans synapses by TurboID-based proximity labeling. J Biol Chem. 297: 101094. 455.","pubmedId":"34416233","doi":"10.1016/j.jbc.2021.101094"},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development. 142: 4374-84. 518.","pubmedId":"26552885","doi":"10.1242/dev.129635"},{"reference":"Kurashina M, Mizumoto K. 2023. Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. STAR Protoc. 4: 102028. 527.","pubmedId":"36640369","doi":"10.1016/j.xpro.2022.102028"},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet. 17: e1009755. 529.","pubmedId":"34748534","doi":"10.1371/journal.pgen.1009755"},{"reference":"Cheloha RW, Harmand TJ, Wijne C, Schwartz TU, Ploegh HL. 2020. Exploring cellular biochemistry with nanobodies. J Biol Chem. 295: 15307-15327. 530.","pubmedId":"32868455","doi":"10.1074/jbc.REV120.012960"},{"reference":"Quintin S, Saad MI, Amann G, Reymann AC. 2025. In vivo detection of ALFA-tagged proteins in C. elegans with a transgenic fluorescent nanobody. MicroPubl Biol. 2025 531.","pubmedId":"40321834","doi":"10.17912/micropub.biology.001542"},{"reference":"Igreja C, Loschko T, Schafer A, Sharma R, Quiobe SP, Aloshy E, Witte H, Sommer RJ. 2022. Application of ALFA-Tagging in the Nematode Model Organisms Caenorhabditis elegans and Pristionchus pacificus. Cells. 11 532.","pubmedId":"36497133","doi":"10.3390/cells11233875"},{"reference":"Kim AR, Xu J, Cheloha R, Mohr SE, Zirin J, Ploegh HL, Perrimon N. 2022. NanoTag Nanobody Tools for Drosophila In Vitro and In Vivo Studies. Curr Protoc. 2: e628. 533.","pubmedId":"36571722","doi":"10.1002/cpz1.628"},{"reference":"Xu J, Kim AR, Cheloha RW, Fischer FA, Li JSS, Feng Y, et al., Perrimon N. 2022. Protein visualization and manipulation in Drosophila through the use of epitope tags recognized by nanobodies. Elife. 11 534.","pubmedId":"35076390","doi":"10.7554/eLife.74326"},{"reference":"Wang Z, Hu F, Xue F, He W, Yuan L, Xu P. 2025. ALFA nanobody-guided endogenous labeling. Nat Chem Biol 535.","pubmedId":"40883491","doi":"10.1038/s41589-025-02019-7"},{"reference":"Van Der Salm E, Schroeder MH, Steller LB, Miller SI, Scheper A, Nowee G, Griffin EE, Ruijtenberg S. 2026. Epitope-based labeling for improved live-imaging of endogenous proteins in C. elegans. G3 (Bethesda) 650.","pubmedId":"42671252","doi":"10.1093/g3journal/jkag212"},{"reference":"Neveu J, Spielmann J, Fanara S, Delesalle C, Cantaloube S, Vert G. 2025. Broad application of plant protein tagging with ALFA tag for nanobody-based imaging and biochemical approaches. bioRxiv: 2025.03.19.644120. 651.","pubmedId":"","doi":"10.1101/2025.03.19.644120"},{"reference":"Gregory EF, Ragle JM, Ward JD, Starr DA. 2023. Split-GFP lamin as a tool for studying C. elegans LMN-1 dynamics in vivo. MicroPubl Biol. 2023 652.","pubmedId":"38152058","doi":"10.17912/micropub.biology.001022"},{"reference":"Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. 2016. Translation readthrough mitigation. Nature. 534: 719-23. 653.","pubmedId":"27281202","doi":"10.1038/nature18308"},{"reference":"Barykina NV, Carey EM, Oliinyk OS, Mendonca Gomes JM, De Oliveira S, Nimmerjahn A, Verkhusha VV. 2026. Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labeling and functional imaging. Nat Methods. 23: 972-985. 654.","pubmedId":"42020773","doi":"10.1038/s41592-026-03056-3"},{"reference":"Virant D, Traenkle B, Maier J, Kaiser PD, Bodenhofer M, Schmees C, et al., Rothbauer U. 2018. A peptide tag-specific nanobody enables high-quality labeling for dSTORM imaging. Nat Commun. 9: 930. 655.","pubmedId":"29500346","doi":"10.1038/s41467-018-03191-2"},{"reference":"Zeghal M, Matte K, Venes A, Patel S, Laroche G, Sarvan S, et al., Giguere PM. 2023. Development of a V5-tag-directed nanobody and its implementation as an intracellular biosensor of GPCR signaling. J Biol Chem. 299: 105107. 656.","pubmedId":"37517699","doi":"10.1016/j.jbc.2023.105107"},{"reference":"Yanagi KS, Chen BJ, Kunjo SO, Topalidou I, Lehrbach N. 2026. Lysine deficiency within a conserved lysine desert is critical for EEL-1/HUWE1 to support ubiquitin proteasome system function. PLoS Genet. 22: e1012273. 657.","pubmedId":"42574471","doi":"10.1371/journal.pgen.1012273"},{"reference":"Hefel A, Smolikove S. 2019. Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline. G3 (Bethesda). 9: 1933-1943. 658.","pubmedId":"30992318","doi":"10.1534/g3.119.400162"},{"reference":"He S, Cuentas Condori A, Miller DM. 2019. NATF (Native and Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. Genetics. 212: 387-395. 659.","pubmedId":"30952669","doi":"10.1534/genetics.119.302063"},{"reference":"Feng S, Varshney A, Coto Villa D, Modavi C, Kohler J, Farah F, et al., Huang B. 2019. Bright split red fluorescent proteins for the visualization of endogenous proteins and synapses. Commun Biol. 2: 344. 660.","pubmedId":"31552297","doi":"10.1038/s42003-019-0589-x"},{"reference":"Noma K, Goncharov A, Ellisman MH, Jin Y. 2017. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 6 661.","pubmedId":"28767038","doi":"10.7554/eLife.26376"}],"title":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans.
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"93453e56-20c9-4b50-b9ad-425f05484af8","decision":"publish","abstract":"Understanding protein function requires tools to visualize and manipulate proteins in vivo. NanoTags, short epitope tags that are recognized by single-chain antibodies, are an emerging method for versatile in vivo labelling and manipulation of endogenous proteins. The short (13 amino acid) ALFA tag has been shown to allow labelling of endogenous proteins in several model systems, including C. elegans. Here we describe the generation and validation of transgenes to facilitate global and tissue-specific visualization of ALFA-tagged endogenous proteins in C. elegans. We propose a modular NanoTag system as a powerful approach for investigating protein functions in vivo in C. elegans.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["writing_reviewEditing","methodology","investigation"],"email":"etopalid@fredhutch.org","firstName":"Irini","lastName":"Topalidou","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-1115-4251"},{"affiliations":["Fred Hutchinson Cancer Center, Seattle, Washington, United States"],"departments":["Basic Sciences Division"],"credit":["conceptualization","fundingAcquisition","writing_originalDraft","investigation","methodology","visualization"],"email":"nlehrbach@fredhutch.org","firstName":"Nicolas","lastName":"Lehrbach","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7342-4136"}],"awards":[{"awardId":"R35 GM142728","funderName":"National Institutes of Health (United States)","awardRecipient":"Nicolas Lehrbach"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/36598ea216159192df6076b5527de08e.jpg"},"imageCaption":"(A) Fluorescence images showing expression of NbALFA::GFP and labelling of ALFA-tagged endogenous proteins. Images of WT animals are included to show levels and localization of NbALFA::GFP in the absence of an ALFA-tagged target protein. ALFA-tagged nuclear proteins HIS-72 and LMN-1 cause increased nuclear localization of NbALFA::GFP. Expression of UNC-54 is restricted to the body wall muscle, so introduction of the tag does not alter NbALFA::GFP localization in non-muscle tissues (see panel (D) for a higher magnification image showing NbALFA::GFP-mediated labelling of UNC-54::ALFA in muscle cells).
(B) Fluorescence images showing expression of NbALFA::tagRFP and labelling of ALFA-tagged nuclear lamin LMN-1.
(C) High magnification fluorescence images showing labelling of ALFA-tagged HIS-72 and LMN-1 using NbALFA::GFP.
(D) High magnification image showing labelling of ALFA-tagged UNC-54 in the body wall muscle using NbALFA::GFP. An image of an animal in which UNC-54 is directly tagged with GFP is shown for comparison. NbALFA labelling is not as bright and is not accompanied by disruption of muscle fibers.
(E) Fluorescence images showing tissue-specific labelling of ALFA-tagged HIS-72 with NbALFA::GFP.
","imageTitle":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans
","methods":"
C. elegans husbandry.
C. elegans were maintained on standard nematode growth media (NGM) at 20°C and fed E. coli OP50. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). The following strains were used in this study are listed below.
Strain name | Genotype | Reference |
(Yanagi et al., 2026) | ||
unc-119(kst33) III; nicSi749 [rpl-28p::NbALFA::tagRFP::tbb-2] | (Yanagi et al., 2026) | |
lmn-1(nic1723[ALFA]) I; unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
his-72(nic1725[ALFA]) III unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
unc-54(nic1731[ALFA]) I; unc-119(kst33) III; nicSi744[rpl-28p::NbALFA::GFP::tbb-2] V | this study | |
lmn-1(nic1724[ALFA]) I; unc-119(kst33) III; nicSi749[rpl-28p::NbALFA::tagRFP::tbb-2] | this study | |
NJL5334 | this study | |
this study | ||
this study | ||
NJL5392 | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi813[myo-3p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi808[sng-1p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi823[vha-6p::NbALFA::GFP::tbb-2] | this study | |
his-72(nic1725[ALFA]) unc-119(kst33) III; nicSi832[col-10p::NbALFA::GFP::tbb-2] | this study | |
(Arribere et al., 2016) |
Plasmid constructs and generation of transgenic animals.
All cloning was carried out using the NEBuilder HiFi DNA Assembly kit (New England Biolabs #E2621). The sequence encoding NbALFA was codon-optimized for expression in C. elegans using the transgenebuilder tool (Beta Version; https://www.wormbuilder.org/transgenebuilder/) and synthesized to include a single intron (from the rps-0 gene) and a C-terminal in-frame linker sequence (STSGGSGGTGGSS). Gene synthesis was carried out by Twist Biosciences. Gibson assembly was used to generate plasmids in which NbALFA fusion proteins are expressed under the control of various promoters: rpl-28 promoter (ubiquitous expression, 605 bp immediately upstream of the rpl-28 ORF), myo-3 promoter (body wall muscle expression, 2139 bp immediately upstream of the myo-3 ORF), sng-1 promoter (neuronal expression, 2080 bp immediately upstream of the sng-1 ORF), vha-6 promoter (intestinal expression, 934 bp immediately upstream of the vha-6 ORF), col-10 promoter (hypodermal expression, 1126 bp immediately upstream of the col-10 ORF). All constructs are followed by the tbb-2 3'UTR (376 bp immediately downstream of the tbb-2 stop codon). These constructs were inserted into the pNL43 backbone, which contains a cbr-unc-119 rescue cassette (Lehrbach & Ruvkun, 2016). The plasmids were used to generate transgenic (miniMos insertion) animals harboring single-copy transgenes (Frokjaer-Jensen et al., 2014). We did not systematically determine the integration sites of the miniMos insertions. We assigned linkage of one of the insertions (nicSi744) based on segregation away from markers on chromosome V. Plasmids used in this study are listed below.
Plasmid | Description |
pNL549 | |
pNL559 | |
pNL594 | |
pNL595 | |
pNL596 | |
pNL598 |
Gene editing by CRISPR/Cas9.
CRISPR/Cas9 genome editing was carried out through microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1081058, #1072532, and custom crRNA) along with single-stranded oligonucleotides (IDT) as homology-directed repair (HDR) templates (Ghanta & Mello, 2020; Paix et al., 2015). All CRISPR edits were identified by diagnostic PCR and confirmed by sequencing. Guide RNAs and HDR oligos used in this study are listed below.
Edit created | Guide RNA sequence | HDR oligo sequence |
ALFA::his-72 | GGTACGAGCCATTGTTGTTC | AttctcaatttccagaacaacaATGCCAT CCCGGCTCGAGGAAGAGCTCCGTCGACGT CTCACCGAGCCAGCTCGTACCAAGCAAAC CGCTCGTAAATCC |
ALFA::lmn-1 | AGAAAAATGTCATCTCGTAA
| taactcttcagaaagcagcgagaaaaATG CCATCCCGGCTCGAGGAAGAGCTCCGTCG ACGTCTCACCGAGCCATCATCTCGTAAAG GTACTCGTAGTTCT |
unc-54::ALFA | TAATTGGACTTAGAAGTCAG
| CCATCTCGCGCCCGTGCCTCTGACTTCCC ATCCCGGCTCGAGGAAGAGCTCCGTCGAC GTCTCACCGAGTAAgtccaattactcttc aacatccct |
Microscopy
Fluorescence images were collected on a Leica M165FC equipped with a 910 Leica K5 sCMOS camera using LAS X software (version 3.7.5.24914) or on a Zeiss AxioImager Z1 equipped with an Axiocam 705 CMOS camera and using ZEN software (version 3.3.89.0003). Worms were immobilized using sodium azide and mounted on 2% agarose pads. All images were processed and analyzed using ImageJ/Fiji software (version 2.16.0/1.54p).
","reagents":"","patternDescription":"Studies of protein function rely on labelling tools to visualize or manipulate proteins in vivo. In genetically tractable model organisms such as C. elegans, CRISPR-mediated gene editing can be used to knock in fluorescent or other functionalized tags to endogenous proteins for visualization and/or manipulation (Artan et al., 2021; Ghanta & Mello, 2020; Kurashina & Mizumoto, 2023; Schwartz et al., 2021; Zhang et al., 2015). However, directly tagging proteins of interest is not ideal for all applications. Tags such as GFP or other fluorescent proteins are valuable for protein visualization by live microscopy. However, their relatively large size can interfere with protein structure or function. Further, directly tagging endogenous loci causes labelling of the protein of interest in all tissues where it is expressed, which can complicate analysis of tissue-specific protein functions. Finally, tagging a single protein with multiple fluorescent or other functional tags requires the generation and validation of a new edited line for each tag. Expanding the repertoire and modularity of tools for endogenous protein labelling would therefore accelerate research into protein function in vivo.
NanoTags, short epitope tags that are bound at high affinity by single-chain antibodies (nanobodies, or Nbs), offer several advantages for in vivo labelling of endogenous proteins (Cheloha et al., 2020). NanoTag epitopes are typically small (~10-15 amino acids), reducing the possibility that the tag interferes with protein folding or function. Nanobodies can readily be expressed as recombinant proteins via transgenes, a strategy that has been used to label tagged proteins in various experimental systems (Igreja et al., 2022; Kim et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Virant et al., 2018; Wang et al., 2025; Xu et al., 2022; Zeghal et al., 2023). The 13 amino acid ALFA-tag is recognized with high specificity and affinity by an ALFA-specific nanobody (NbALFA) (Gotzke et al., 2019). CRISPR/Cas9-mediated knock-in of an ALFA-tag allows detection or labelling of endogenous proteins with NbALFA (Igreja et al., 2022; Neveu et al., 2025; Quintin et al., 2025; van der Salm et al., 2026; Wang et al., 2025; Xu et al., 2022). Transgenic strains that express NbALFA fusions in C. elegans germline have been produced by two labs (NbALFA::mKate2, Quintin et al., 2025; and NbALFA::HaloTag, van der Salm et al., 2026) and shown to enable live imaging of ALFA-tagged endogenous proteins in the germline and embryos. Here, we confirm the broad utility of NbALFA for labelling endogenous proteins, by using transgenes to drive whole-animal and tissue-specific expression of NbALFA fusion proteins.
We generated constructs in which an NbALFA::GFP or an NbALFA::tagRFP fusion is controlled by the promoter of the ubiquitously expressed rpl-28 gene. We then generated single-copy insertion lines for each construct using miniMos (Frokjaer-Jensen et al., 2014). We observed diffuse nuclear and cytosolic fluorescence in NbALFA::GFP and NbALFA::tagRFP transgenic animals. To test the ability of the NbALFA fusions to recognize ALFA-tagged endogenous proteins, we used CRISPR/Cas9 to ALFA-tag highly expressed proteins with easily detectable localization patterns: his-72, encoding a histone H3.3, which is expressed in all tissues and localizes to chromatin in the nucleus; lmn-1, encoding a nuclear lamin; and unc-54, which encodes myosin heavy chain (MHC B) expressed specifically in body wall muscle. In each case, we observed localization patterns consistent with specific labelling of the endogenously tagged protein (Fig. 1A-D).
We noticed a slight increase in the overall fluorescence of NbALFA::GFP and NbALFA::tagRFP following ALFA-tagging of abundant endogenous proteins (Fig. 1A-C). This appears to be a specific effect of the interaction between the NbALFA fusion and its target protein: UNC-54 is expressed specifically in muscle, and we did not observe a change in NbALFA::GFP levels in non-muscle cells of unc-54::ALFA animals (Fig. 1A). These observations suggest that NbALFA fusion proteins are unstable when they are not bound to a target ALFA-tagged protein. A similar effect has been observed in mammalian cells, suggesting that NbALFA is generally unstable in animal cells unless bound to an ALFA-tagged target protein (Wang et al., 2025).
Labelling of endogenous proteins with fluorescent tags can, in some cases, interfere with the function of the tagged protein. GFP-tagging of LMN-1 and of the muscle myosin UNC-54 both cause sluggish locomotion, suggesting impaired function of the tagged protein (Arribere et al., 2016; Gregory et al., 2023). However, we did not observe any obvious change in locomotion of animals in which LMN-1::ALFA or UNC-54::ALFA is labelled by NbALFA::GFP. The organization of muscle filaments appears disrupted in unc-54::gfp animals but not in animals in which UNC-54::ALFA is labelled via NbALFA::GFP (Fig. 1D). These observations support the conclusion that ALFA-tagging provides a means to tag and visualize the localization of endogenous proteins by live imaging without the drawbacks of direct addition of a bulky fluorescent tag that can interfere with protein structure or function.
Finally, we sought to test the possibility of using NbALFA fusion proteins to label endogenous proteins in a tissue-specific manner. We generated transgenic animals expressing NbALFA::GFP under the control of several tissue-specific promoters and tested their ability to label HIS-72::ALFA in the corresponding tissues. In each case, we detected the expected increase in nuclear localization of NbALFA::GFP, indicating tissue-specific labelling of histone H3 (Fig. 1E). In addition to labelling of HIS-72 in the nucleus, we observed additional cytosolic signal in some tissues, which was especially pronounced with hypodermal col-10p::NbALFA::GFP. It is possible that strong expression of tissue-specific promoters leads to increased background signal from NbALFA::GFP that is not bound to the ALFA-tagged target.
Here, we have generated transgenic strains expressing NbALFA fused to fluorescent proteins to facilitate global and tissue-specific fluorescent labelling using NanoTagging in C. elegans. Our work provides new ways to achieve labelling in entire animals or in specific somatic tissues, which complements tools for labelling ALFA-tagged proteins in C. elegans already generated by other groups (Quintin et al., 2025; van der Salm et al., 2026). Importantly, van der Salm and colleagues' work demonstrates the use of orthogonal labelling strategies in combination with the ALFA tag for simultaneous live imaging of multiple proteins and discusses the advantages of indirect labelling in detail (van der Salm et al., 2026). We note that the transgenes we generated are randomly inserted into the genome via miniMos and we have not systematically determined their integration sites. Insertions of similar transgenes for tissue-specific NbALFA labelling at defined safe-harbor loci would improve their utility.
Because the short ALFA-tag is straightforward to introduce via CRISPR/Cas9, these tools can be used to quickly generate strains in which any protein of interest is labelled. We tested this system for labelling highly abundant proteins but have not yet carefully evaluated the extent of background signal (i.e. we do not know what fraction of fluorescent signal is derived from NbALFA::GFP/tagRFP molecules that are not bound to their target). This caveat of the ALFA-tagging approach contrasts with split-GFP labelling, in which the fluorophore is reconstituted upon binding to the target protein, yielding minimal background signal (Feng et al., 2019; He et al., 2019; Hefel & Smolikove, 2019; Noma et al., 2017). ALFA-tagging may be an attractive alternative to split-GFP in cases where background signal is not a concern, or where maximizing signal is important, since reconstituted split-GFP is much dimmer than intact GFP (Feng et al., 2019). Given the potential for background signal to complicate analysis, it will be important to test the ALFA system for detection of less abundant proteins and to explore strategies for increasing labelling specificity, perhaps by using NbALFA variants whose stability or fluorescence of the attached fluorophore is dependent on binding to an ALFA-tagged target (Barykina et al., 2026; Wang et al., 2025). Labelling efficiency could also be enhanced by incorporating multiple tags in tandem to a target protein, as van der Salm and colleagues demonstrate using the SunTag System.
Improving and expanding the NanoTag toolkit will enable new applications. For example, cell-type specific promoters would allow labelling of endogenous proteins with greater anatomical specificity. Fusion of NbALFA to other functional partners could be used to achieve various tissue-specific manipulations. Potential applications could include tissue-specific proximity labelling, manipulation of protein localization, protein-protein interactions, or stability. In conclusion, these tools and those reported by others (Igreja et al., 2022; Quintin et al., 2025; van der Salm et al., 2026) support the usefulness of NanoTags in C. elegans. We hope that continued development of NanoTagging tools for C. elegans will enable new approaches to investigating protein function in vivo.
","references":[{"reference":"Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. 2016. Translation readthrough mitigation. Nature. 534: 719-23. 653.","pubmedId":"27281202","doi":"10.1038/nature18308"},{"reference":"Artan M, Barratt S, Flynn SM, Begum F, Skehel M, Nicolas A, De Bono M. 2021. Interactome analysis of Caenorhabditis elegans synapses by TurboID-based proximity labeling. J Biol Chem. 297: 101094. 455.","pubmedId":"34416233","doi":"10.1016/j.jbc.2021.101094"},{"reference":"Barykina NV, Carey EM, Oliinyk OS, Mendonca Gomes JM, De Oliveira S, Nimmerjahn A, Verkhusha VV. 2026. Synthetic multicolor antigen-stabilizable nanobody platform for intersectional labeling and functional imaging. Nat Methods. 23: 972-985. 654.","pubmedId":"42020773","doi":"10.1038/s41592-026-03056-3"},{"reference":"Cheloha RW, Harmand TJ, Wijne C, Schwartz TU, Ploegh HL. 2020. Exploring cellular biochemistry with nanobodies. J Biol Chem. 295: 15307-15327. 530.","pubmedId":"32868455","doi":"10.1074/jbc.REV120.012960"},{"reference":"Feng S, Varshney A, Coto Villa D, Modavi C, Kohler J, Farah F, et al., Huang B. 2019. Bright split red fluorescent proteins for the visualization of endogenous proteins and synapses. Commun Biol. 2: 344. 660.","pubmedId":"31552297","doi":"10.1038/s42003-019-0589-x"},{"reference":"Frokjaer Jensen C, Davis MW, Sarov M, Taylor J, Flibotte S, La Bella M, et al., Jorgensen EM. 2014. Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods. 11: 529-34. 282.","pubmedId":"24820376","doi":"10.1038/nmeth.2889"},{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics. 216: 643-650. 217.","pubmedId":"32963112","doi":"10.1534/genetics.120.303564"},{"reference":"Gotzke H, Kilisch M, Martinez Carranza M, Sograte Idrissi S, Rajavel A, Schlichthaerle T, et al., Frey S. 2019. The ALFA-tag is a highly versatile tool for nanobody-based bioscience applications. Nat Commun. 10: 4403. 410.","pubmedId":"31562305","doi":"10.1038/s41467-019-12301-7"},{"reference":"Gregory EF, Ragle JM, Ward JD, Starr DA. 2023. Split-GFP lamin as a tool for studying C. elegans LMN-1 dynamics in vivo. MicroPubl Biol. 2023 652.","pubmedId":"38152058","doi":"10.17912/micropub.biology.001022"},{"reference":"He S, Cuentas Condori A, Miller DM. 2019. NATF (Native and Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. Genetics. 212: 387-395. 659.","pubmedId":"30952669","doi":"10.1534/genetics.119.302063"},{"reference":"Hefel A, Smolikove S. 2019. Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline. G3 (Bethesda). 9: 1933-1943. 658.","pubmedId":"30992318","doi":"10.1534/g3.119.400162"},{"reference":"Igreja C, Loschko T, Schafer A, Sharma R, Quiobe SP, Aloshy E, Witte H, Sommer RJ. 2022. Application of ALFA-Tagging in the Nematode Model Organisms Caenorhabditis elegans and Pristionchus pacificus. Cells. 11 532.","pubmedId":"36497133","doi":"10.3390/cells11233875"},{"reference":"Kim AR, Xu J, Cheloha R, Mohr SE, Zirin J, Ploegh HL, Perrimon N. 2022. NanoTag Nanobody Tools for Drosophila In Vitro and In Vivo Studies. Curr Protoc. 2: e628. 533.","pubmedId":"36571722","doi":"10.1002/cpz1.628"},{"reference":"Kurashina M, Mizumoto K. 2023. Targeting endogenous proteins for spatial and temporal knockdown using auxin-inducible degron in Caenorhabditis elegans. STAR Protoc. 4: 102028. 527.","pubmedId":"36640369","doi":"10.1016/j.xpro.2022.102028"},{"reference":"Lehrbach NJ, Ruvkun G. 2016. Proteasome dysfunction triggers activation of SKN-1A/Nrf1 by the aspartic protease DDI-1. Elife. 5: e17721. 5.","pubmedId":"27528192","doi":"10.7554/eLife.17721"},{"reference":"Neveu J, Spielmann J, Fanara S, Delesalle C, Cantaloube S, Vert G. 2025. Broad application of plant protein tagging with ALFA tag for nanobody-based imaging and biochemical approaches. bioRxiv: 2025.03.19.644120. 651.","pubmedId":"","doi":"10.1101/2025.03.19.644120"},{"reference":"Noma K, Goncharov A, Ellisman MH, Jin Y. 2017. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 6 661.","pubmedId":"28767038","doi":"10.7554/eLife.26376"},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 201: 47-54. 283.","pubmedId":"26187122","doi":"10.1534/genetics.115.179382"},{"reference":"Quintin S, Saad MI, Amann G, Reymann AC. 2025. In vivo detection of ALFA-tagged proteins in C. elegans with a transgenic fluorescent nanobody. MicroPubl Biol. 2025 531.","pubmedId":"40321834","doi":"10.17912/micropub.biology.001542"},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet. 17: e1009755. 529.","pubmedId":"34748534","doi":"10.1371/journal.pgen.1009755"},{"reference":"Van Der Salm E, Schroeder MH, Steller LB, Miller SI, Scheper A, Nowee G, Griffin EE, Ruijtenberg S. 2026. Epitope-based labeling for improved live-imaging of endogenous proteins in C. elegans. G3 (Bethesda) 650.","pubmedId":"42671252","doi":"10.1093/g3journal/jkag212"},{"reference":"Virant D, Traenkle B, Maier J, Kaiser PD, Bodenhofer M, Schmees C, et al., Rothbauer U. 2018. A peptide tag-specific nanobody enables high-quality labeling for dSTORM imaging. Nat Commun. 9: 930. 655.","pubmedId":"29500346","doi":"10.1038/s41467-018-03191-2"},{"reference":"Wang Z, Hu F, Xue F, He W, Yuan L, Xu P. 2025. ALFA nanobody-guided endogenous labeling. Nat Chem Biol 535.","pubmedId":"40883491","doi":"10.1038/s41589-025-02019-7"},{"reference":"Xu J, Kim AR, Cheloha RW, Fischer FA, Li JSS, Feng Y, et al., Perrimon N. 2022. Protein visualization and manipulation in Drosophila through the use of epitope tags recognized by nanobodies. Elife. 11 534.","pubmedId":"35076390","doi":"10.7554/eLife.74326"},{"reference":"Yanagi KS, Chen BJ, Kunjo SO, Topalidou I, Lehrbach N. 2026. Lysine deficiency within a conserved lysine desert is critical for EEL-1/HUWE1 to support ubiquitin proteasome system function. PLoS Genet. 22: e1012273. 657.","pubmedId":"42574471","doi":"10.1371/journal.pgen.1012273"},{"reference":"Zeghal M, Matte K, Venes A, Patel S, Laroche G, Sarvan S, et al., Giguere PM. 2023. Development of a V5-tag-directed nanobody and its implementation as an intracellular biosensor of GPCR signaling. J Biol Chem. 299: 105107. 656.","pubmedId":"37517699","doi":"10.1016/j.jbc.2023.105107"},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development. 142: 4374-84. 518.","pubmedId":"26552885","doi":"10.1242/dev.129635"}],"title":"Tools for in vivo labelling of ALFA-tagged proteins in C. elegans.
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"a175f3db-df1e-4cc8-89a9-4af528f30f64","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}