microPublication Biology 2578-9430 Caltech Library 10.17912/micropub.biology.000082 Materials and Reagents Methods C. elegans DVC interneuron cGAL driver in Caenorhabditis elegans Oh Jun Young 1 § Gharib Shahla 1 Liu Jonathan 1 Wang Han 1 Sternberg Paul 1 Division of Biology and Biological Engineering, California Institute of Technology. Pasadena CA 91125 Hope Ian Correspondence to: Jun Young Oh ( ojy@caltech.edu )

JO: Conceptualization, Methodology, Data curation, Investigation, Validation, Writing - original draft

SG: Investigation

JL: Conceptualization, Methodology, Supervision, Writing - review and editing

HW: Conceptualization, Methodology, Supervision, Writing - review and editing

PS: Conceptualization, Methodology, Funding acquisition, Project administration, Supervision, Writing - review and editing

 6 3 2019 2019 2019 10.17912/micropub.biology.000082 12 12 2018 1 1 1970 26 2 2019 Copyright: © 2019 by the authors 2019 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Expression of GFP in the DVC neuron in the tail of a L4 hermaphrodite Caenorhabditis elegans . The integrated cGAL driver line (PS8129) using a ceh-63 promoter was crossed with the UAS-GFP effector strain (PS6843) and double homozygous animals (PS8131) containing both the driver and effector were imaged. GFP, DIC overlay (A) and GFP only (B) images are shown. Arrowhead indicates anus.

Description

cGAL, a recently developed temperature-robust bipartite GAL4-UAS system in C. elegans , consists of two components: a cGAL “driver” that expresses the cGAL protein in specific cells using a promoter (i.e. neuron-specific or tissue-specific), and an “effector” that carries a gene of interest downstream of UAS (Wang et al ., 2017). Crossing or combining a driver with an effector leads to the expression of the gene of interest in a cell-specific or tissue-specific manner.

Here we report a new cGAL driver for the DVC interneuron. The ceh-63 promoter was chosen due to its restricted expression in the DVC neuron (Feng et al . 2012). The DVC interneuron driver construct containing the ceh-63 promoter (646 bp upstream of ATG translation start site) was injected into N2 and an integrated DVC driver line was generated. When crossed with the UAS-GFP effector strain (PS6843), the ceh-63 cGAL driver dictated GFP expression in the single DVC neuron (Figure 1), in addition to GFP in the coelomocyte from P unc-122::gfp co-injection marker. We did not observe GFP expression in uterus as reported by Feng et al., 2012.

Methods

Molecular cloning :

pcGAL0073 (P ceh-63::cGAL ) driver plasmid was constructed from pcGAL0013 (P rab-3::cGAL ) vector (Wang et al ., 2017). 646 bp ceh-64 promoter upstream of isoform a ATG translation start site was obtained through PCR of N2 genomic DNA using NEB Phusion High Fidelity Polymerase with the forward primer 5’ CCCGGCCGGCCGAGACCGAATCAGCACCACC 3’ and the reverse primer 5’ CCCGGCGCGCCGCTAACAACACAATGAGCAAAACAG 3’. FseI and AscI restriction sites were added to the 5’ ends of the primers in order to ligate the ceh-63 promoter PCR product into the vector. Both the vector and the ceh-63 promoter PCR product was digested for 45 min at 37°C with FseI and AscI, and ligated using NEB T4 DNA ligase. The ceh-63 promoter sequence in pcGAL0073 was confirmed by Sanger sequencing (Laragen, CA).

Injection mix :  25 ng/μl of pcGAL0073 was mixed with 30 ng/μl of P unc-122::gfp co-injection marker and 145 ng/μl of 1kb DNA ladder carrier (NEB, MA). The mixture was injected into fifteen N2 animals and a stable extrachromosomal array line was obtained for integration by X-ray irradiation (Evans 2006), generating syIs530 .

Florescence imaging : DVC neuron was imaged using Zeiss Imager Z2 under a Zeiss Imager Z2 with an Apotome 2.0 and a 100x oil objective using Zen Blue 2.3.

Reagents
Strain Genotype Additional information
PS8129 syIs530 II Outcrossed three times
PS8131 syIs530 II ; syIs300 V Slightly sterile, not outcrossed. DVC driver with GFP effector.
Funding

R21 MH115454/MH/NIMH NIH HHS/United States

 Feng H Reece-Hoyes JS Walhout AJ Hope IA 2011 12 19 A regulatory cascade of three transcription factors in a single specific neuron, DVC, in Caenorhabditis elegans. Gene 494 1 0378-1119 73 84} 10.1016/j.gene.2011.11.042 22207033 Wang H Liu J Gharib S Chai CM Schwarz EM Pokala N Sternberg PW 2016 12 19 cGAL, a temperature-robust GAL4-UAS system for Caenorhabditis elegans. Nat Methods 14 2 1548-7091 145 148} 10.1038/nmeth.4109 27992408 Evans, T. C., ed. Transformation and microinjection (April 6, 2006), WormBook, ed. The C. elegans Research Community, WormBook, http://www.wormbook.org.