JC: Conceptualization, Formal analysis, Investigation, Methodology, Data curation, Visualization, Writing - original draft, Writing - review and editing
TS: Conceptualization, Funding acquisition, Supervision, Writing - review and editing, Resources
Polymerase Chain Reaction (PCR) is a powerful tool to detect natural variation or experimentally introduced variation in research and clinical settings and a widely-used method for genotyping. Single nucleotide polymorphisms (SNP) detection is challenging by PCR as the variant and wild type alleles differ by only one nucleotide. Traditional methods to detect SNPs, including Sanger sequencing and commercial kits, are usually time-consuming. Here we describe a simple primer design strategy that enables specific variant detection through regular one-step PCR. The strategy employs the differential efficiency of genomic PCR using a primer that has a single mismatch with the chromosome that contains the SNP to be detected (typically the variant allele) versus two mismatches with the corresponding alternative allele (typically the wild type allele). To date, we have successfully employed this approach to detect more than 20 SNPs. The simplicity and robustness of the approach allows rapid application to legacy mutations as well as newly discovered or generated SNPs.
(A) Schematic showing the primer design strategy to discriminate between the variant and wild type alleles through PCR (compare I and II, III and IV). The SNP residue is denoted as position 0. G, in red, is the variant allele, while T, in green, is the wild type allele. The forward PCR primer was designed to specifically detect either the variant or wild type allele, with the 3’ end starting at the SNP residue (G or T at position 0). For the allele to be detected, there is no mismatch at position 0, while for the other allele, there is a mismatch (I versus II, and III versus IV). To increase the specificity for the allele to be detected by PCR, a second change (C to A in these examples, in blue) was introduced at the -2 position, two nucleotides upstream of the SNP position. For examples I and II, the variant forward primer can bind more efficiently to the variant allele (one mismatch in I) than the wild type allele (two mismatches in II), resulting in a more robust PCR amplification of the variant allele. Similarly for examples III and IV, the wild type forward primer can detect the wild type allele (shown in III) more effectively than the variant allele (shown in IV). “X” indicates mismatch,
Single nucleotide polymorphisms (SNPs) are the most common genetic variation between natural populations of a species, are the frequent cause of phenotypes observed in organisms from forward genetic chemical mutagenesis screens, and are employed to probe the functional consequences of missense and noncoding changes made by CRISPR/Cas9 gene editing (Brenner, 1974; Okamoto
Key to the approach is a robust PCR method to detect one allele but not the other at a SNP residue (Figure 1A). A forward and a reverse primer are needed for each PCR reaction. We have designed the forward primer to more efficiently amplify one of the alleles. There are two important features of the forward primer. First, the 3’ nucleotide of the primer is at the SNP, denoted as 0 position, and pairs with the SNP residue to be detected but is mismatched with the other allele residue. Therefore the variant and wild type primers have different bases at their 3′ end. Second, two bases upstream of the SNP position, denoted as -2 position, an additional change was introduced that is a mismatch with both the variant and wild type alleles (Figure 1A, in blue in examples I to IV), to further discriminate between the two alleles in PCR. The reverse primer is identical in both cases. As shown in Figure 1A examples I to IV, the variant allele “G” and complement “C” are highlighted in red, and the wild type allele “T” and complement “A” are in green (Figure 1A). The variant primer has one mismatch relative to the variant allele (Fig. 1A, example I), compared to two mismatches relative to the wild type allele (Fig. 1A, example II). Therefore the variant primer can selectively amplify the variant allele. Similarly, the wild type primer can specifically detect the wild type allele (Figure 1A, examples III and IV). We have successfully applied this primer design strategy to detect the
All primers designed to have Tm between 58 °C to 61 °C. GoTaq DNA Polymerase (Promega, cat#M3008) was used in all PCR reactions described, following the manufacturer’s instructions. The single worm lysis PCR procedure is as previously described (Barstead
Table 1: primers used in this study
|
|
650_glp-1_bn18_variant_F |
gatgaattggaccggaatggtatga
|
649_glp-1_bn18_wildtype_F |
gatgaattggaccggaatggtatga
|
190_glp-1_bn18_R | agagctgttcgtcctttatacttgt |
20_glp-1_q46_variant_F |
gggcaaagaccattctccaaat
|
21_glp-1_q46_R | ctccatcgcctcgtctttcaatac |
766_glp-1_q175_variant_F |
ggaaaatccggtcgatattgtg
|
767_glp-1_q175_R | gcagtgtggtctctgtagtggaa |
630_glp-1_ar202_variant_F |
cagggtattgacatttggagaatggtcttt
|
260_glp-1_ar202_R | gagccacttggagtataatgacgatg |
674_lin-35_n745_variant_F |
ccaaatgacattgttactggtgca
|
675_lin-35_n745_R | tgtcaagcatttcagcaacgga |
684_pha-1_e2123_variant_F |
taacttgatgaacatcggtaatcatac
|
685_pha-1_e2123_R | cttaatgcccttgcaccgtagt |
646_rde-1_ne219_variant_F |
gtggcttctcatgaacttcaagatg
|
192_rde-1_ne219_R | aaatcggacagaggaagaaatgca |
692_lsy-2_ot64_variant_F |
gatctgtgtgtatcactgcatg
|
693_lsy-2_ot64_R | ctgaagaagatgagatggtggaagg |
1149_clp-6_gk194122_variant_F |
ggcagtcgatcatcaattactacatca
|
1150_clp-6_gk194122_R | ccttgttgggtcatttccacgt |
Notes to the table 1: The bold nucleotide at 3’ end of the forward primer denotes either the variant allele or the wild type allele. The italicized nucleotide denotes mismatch change that was introduced two bases upstream of the SNP site. F forward primer; R reverse primer.
R01 GM-100756 to TS