JL: Writing - review & editing, Investigation, Methodology, Formal analysis
CH: Conceptualization, Funding acquisition, Methodology, Project administration, Supervision, Writing - original draft, Writing - review & editing
TB: Conceptualization, Funding acquisition, Investigation, Methodology, Supervision, Writing - original draft, Writing - review & editing
AH: Conceptualization, Formal analysis, Funding acquisition, Methodology, Project administration, Supervision, Writing - original draft, Writing - review & editing
To study important genes involved in Frontotemporal Dementia (
Figure legend. (A) Strategy for deletion of
Here, we focus on
The
Confirming gene conservation often requires cross-species expression and experimental evidence confirming cross-species function. Frequently, studies of protein function, the consequences of clinical variants, and other preclinical studies can be efficiently carried out in “humanized” laboratory animal models. For
When human variants are inserted in the humanized gene, they may be benign, known deleterious alleles, or variants of unknown significance. Using CRISPR gene editing approaches, we inserted the human MAPT coding sequence as a gene replacement of the
To assess phenotypic consequences, we examined the
Next
Based on this and other work, we believe these results highlight the importance of identifying
Neurodegeneration was scored by ability to backfill with DiI (Molecular Probes). Animals were scored as intact if no neuron loss was detected, but note that at a magnification level of 12.5x with moving animals on culture dishes, loss of a single neuron will be missed in some animals. Therefore, animals with 3 or 4 neurons are challenging to distinguish and our results are likely an underestimate of affected neurons. Animals were scored blinded as to genotype. For Day 1 studies, L4 animals were picked to 10mM paraquat NGM plates spread with OP50 and scored the next day. For Day 9, L4 animals were serially passed to new plates (without FUDR) until the 9th day of adulthood. Then, dye filling was undertaken as above, but without paraquat.
Survival was examined while aging animals for neurodegeneration assessment at Day 9; survival was simultaneously assessed in the same population. Animals were censored if they bagged, burst, or escaped.
Knockout (KO) alleles were generated by deletion of the coding sequences and intervening exons using template-driven, CRISPR/Cas9-mediated homologous recombination. For each gene KO, a different co-conversion strategy was used:
Humanization of
Clinical variants were similarly inserted into
Statistical analysis: Student’s t-test used for comparison of neurodegeneration (Microsoft Excel). Kalpan Meier comparison used for survival to Day 9 (www.statskingdom.com/kaplan-meier.html)
Gene |
Outcrossed strain |
Original strain |
Genotype |
|
|
HA3699 |
NMX41 |
|
This study |
|
HA3982 |
NMX329 |
|
This study |
|
HA3988 |
NMX372 |
|
This study |
|
HA3989 |
NMX373 |
|
This study |
|
HA4004 |
NMX405 |
|
This study |
|
HA3701 |
NMX62 |
|
This study |
|
HA3705 |
NMX90 |
|
This study |
|
- |
GE24 |
|
CGC |
|
- |
COP1403 |
|
InVivo Biosystems |
DiI |
1,1'-Dioctadecyl
|
Molecular Probes |
||
XhoI |
XhoI |
New England Biochemicals |
||
Cas9 |
Cas9 protein with NLS |
PNA Bio |
||
Hygromycin B |
Hygromycin B |
Gold Biotechnology |
reference |
sgRNA 1 |
sgRNA 2 |
ssODN sequence or plasmid name |
Source |
|
TAGTCAGGGCTCTTTTCCGG |
AACGCAACACACGTTGCCGG |
GTTTTAGGAAACTCAGTATAGTCAGGGCTCTTTTCTAAATAAATAAACTCGAGCGGAGGCGGAAACGTTCAAATCGAAAACAGGAAGC |
This study |
|
TAGTCAGGGCTCTTTTCCGG |
TGAAAGCATATTATTAAGCG |
pNU2344 - P2A::HumanMAPT WT::hygR |
This study |
|
AATCTCAAGCACCAACCAGG |
TCCAACGTCCAATCCAAATG |
AAGATCGGATCCACCGAGAATCTCAAGCACCAACCCGGAGTGGGTAAAGTACAGATAATAAATAAAAAACTAGACCTATCTAATGTTCAGTCTAAATGCGGATCCAAGGACAATATCAAGCATGTCCCAG |
This study |
|
TTGGTGCTTGAGATTCTCGG |
ATCAAGCATGTCCCAGGAGG |
CTTAAAGAACGTCAAGTCCAAGATCGGATCCACCGAAAACTTGAAGCATCAGCCAGGTGGGGGTAAAGTCCAGATTATTAATAAAAAACTAGACCTATCTAATGTACAGTCAAAGTGTGGGTCTAAAGATAACATAAAACACGTTCTTGGAGGAGGATCTGTCCAAATCGTCTACAAGCCAGTCG |
This study |
|
AAGTTTTTATTCATCACACG |
GCAAACTGCTGTATTTACAC |
TAAAAACAAAAGATTATAAAGTTTTTATTCATCACCTCGAGTTTATTTATTTACACAGGCAACAAACGAAAGAATTTTCCTGTAGGTT |
This study |
|
CAGCTTCTGACAATTTTCGC |
CTGGAATGTGAAGGATGATG |
tagcggcaatttctgaagactgtcggaagccggcgCCTCCCCAGAAGTCCTCCAGTCCTAAATAAATAAACTCGAGATGAGGATGAGGATCAGATTTAAttttacacgttt |
This study |
|
ggatgtcccaggcgaacggg |
N/A |
GAGTCAGAGATGCAATGAAGTTGATGGTGCCACTTTTGATTGACCCAGCCGTGCGGTGTGAAGACCGCCT |
This study |
Plasmid |
Genotype |
Description |
pNU2344 |
|
Donor homology arms for insertion into
|
pNU792 |
|
612bp
|
Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
Supported by NIH R43 AG061978-01