AS: Formal analysis, Methodology, Writing - review & editing, Investigation, Resources, Conceptualization, Validation
AG: Formal analysis, Methodology, Investigation, Writing - review & editing, Conceptualization, Data curation, Visualization
BS: Investigation, Supervision, Writing - review & editing, Project administration, Funding acquisition, Conceptualization, Resources
SS: Conceptualization, Funding acquisition, Project administration, Supervision, Writing - original draft, Writing - review & editing, Formal analysis
Inorganic polyphosphate is a ubiquitous polymer with myriad roles in cell and organismal physiology. Whereas there is evidence for nuclear polyphosphate, its impact on transcriptional regulation in eukaryotes is unkown. Transcriptional profiling of fission yeast cells lacking polyphosphate (via deletion of the catalytic subunit Vtc4 of the Vtc4/Vtc2 polyphosphate polymerase complex) elicited de-repression of four protein-coding genes located within the right sub-telomeric arm of chromosome I that is known to be transcriptionally silenced by the TORC2 complex. These
Inorganic polyphosphate (polyP) is an anionic linear polymer of heterogeneous length found in taxa from all phylogenetic domains. PolyP levels and polymer chain length are determined by a dynamic balance between synthesis by polyP kinase or polyP polymerase enzymes and catabolism by exopolyphosphatase or endopolyphosphatase enzymes and may fluctuate in response to stress or developmental and environmental cues (Kornberg et al. 1999). PolyP plays diverse roles in physiology: as an energy source; a phosphate reservoir during phosphate starvation; a metal chelator; a modulator of blood clotting and fibrinolysis; a post-translation protein modification (lysine polyphosphorylation); a microbial virulence factor; a signaling molecule (Kornberg et al. 1999, Azevedo et al. 2014, Gray et al. 2014, Azevedo et al. 2015, Baker et al. 2018, Bowlin & Gray 2021).
PolyP is especially abundant in yeast cells, e.g., the intracellular concentration of inorganic polyphosphate in budding yeast grown in phosphate-replete medium is 230 mM (with respect to phosphate residues) as compared to 23 mM for orthophosphate (Auesukaree et al. 2004). Yeast polyP is produced by a heterotrimeric membrane-associated VTC complex that synthesizes polyP and simultaneously imports the polyP into the yeast vacuole (Gerasimaite & Mayer 2014, Hothorn et al. 2009, Gerasimaite et al. 2014). Budding yeast has two VTC complexes: the VTC associated with the vacuole consists of Vtc4, Vtc3, and Vtc1 proteins; the VTC associated with the endoplasmic reticulum and nuclear envelope comprises Vtc4, Vtc2, and Vtc1 subunits (Gerasimaite & Mayer 2014, Gerasimaite et al. 2014). Fission yeast has a single heterotrimeric VTC complex that includes a Vtc2 subunit.
Vtc4 is the catalytic subunit of the polyP polymerase; it consists of a cytoplasm-facing N-terminal SPX domain, a central polymerase domain, and a C-terminal membrane anchor domain (Gerasimaite & Mayer 2014). The SPX domain binds and senses the inositol pyrophosphate signaling molecules IP 7 and IP 8 that stimulate polyP synthesis by VTC (Wild et al. 2016, Gerasimaite et al. 2017, Pascual-Ortiz et al. 2021, Schwer et al. 2022). The Vtc4 polymerase domain, which catalyzes manganese-dependent transfer of an NTP γ-phosphate to an inorganic pyrophosphate or phosphate primer (Hothorn et al. 2009), is a member of the triphosphate tunnel metalloenzyme (TTM) family (Lima et al. 1999, Martinez at al. 2015). Vtc2 and Vtc3 are paralogs homologous to Vtc4, but their TTM domains are catalytically inactive.
In budding yeast, vacuolar polyphosphate comprises ~80% of the total polyP content. There exists a pool of nuclear polyP (dependent on Vtc4) that persists in yeast cells engineered so that the intra-vacuolar pool of polyP is depleted (Azevedo & Saiardi 2014, Azevedo et al. 2020). These findings raise the question of whether polyP plays a role in nuclear transactions, especially in gene expression. To our knowledge, there is scant information on whether physiological levels of polyP impact transcriptional regulation in eukarya. To rectify this knowledge gap, we performed transcriptional profiling of fission yeast
cDNAs obtained from three biological replicates, using poly(A)
+
RNA from wild-type and
The protein products of the four
Weisman and colleagues have established that: (i) the fission yeast TORC2 complex (containing the Tor1 protein kinase) and its downstream effector protein kinase Gad8 are present in the nucleus and bound to chromatin (Cohen et al. 2016, Laribee & Weisman 2020); and (ii) TORC2 and Gad8 function to silence the expression of a set of 7 sub-telomeric genes on chromosomes I and II (Cohen et al. 2018) that, not coincidentally, includes all four of the genes up-regulated by
A salient question is whether the transcriptional impact of
The results presented here anent the de-repression of a cluster of normally silenced sub-telomeric genes in fission yeast when polyP synthesis is interdicted genetically resonate with the recent discovery by Jakob and colleagues that deletion of polyP kinase in
Analogous genetic studies of polyP physiology in mammalian cells are not feasible at present, because the mammalian enzyme(s) responsible for polyP synthesis are not known (Desfougères et al. 2020). A surrogate approach has been to overproduce polyP in mammalian cells via ectopic expression of bacterial polyP kinase and document the effects thereof. When this maneuver was applied to human cells, it was found that: (i) high levels of long-chain polyP accumulated in multiple intracellular compartments; and (ii) 313 genes were down-regulated and 47 genes were upregulated in polyP kinase-expressing cells, by the criterion of a statistically significant 25% difference versus non-expressing cells (Bondy-Chorney et al. 2020). If a ≥2-fold difference cut-off is applied, then 102 genes were down-regulated and 8 genes were upregulated. There are caveats to this approach when it comes to inferences about polyP function. To wit: (i) the levels of polyP achieved are excessive, hence non-physiological; (ii) the polyP may localize to intracellular sites where it is not normally present; and (iii) the polyP that does accumulate is skewed toward very long chains. Indeed, studies in budding yeast indicate that forced accumulation of non-physiological levels of polyphosphate outside the vacuole and membrane compartments, achieved via expression of a bacterial polyP kinase, is
The present data instate a role for fission yeast polyP in localized gene silencing, presumably as a participant in the TORC2 pathway of sub-telomeric silencing discovered by the Weisman lab. Based on available knowledge, we can speculate on at least two ways in which polyP may accomplish this. First, polyP can exert effects on cell physiology via non-enzymatic lysine polyphosphorylation of target proteins in vivo, including nuclear proteins such as DNA topoisomerase I, Nsr1, and ribosome biogenesis factors (Azevedo et al. 2015, Bentley-DeSousa et al. 2018, Azevedo et al. 2020). Indeed, among the validated targets of in vivo lysine polyphosphorylation in budding yeast are several proteins involved in chromatin biology: histone H2AZ chaperone Chz1, histone acetyltransferase complex subunit Eaf7, nucleosome assembly factor Hpc2 (Bentley-DeSousa et al. 2018). If lysine polyphosphorylation of nuclear proteins that establish or maintain silenced chromatin over the fission yeast chromosome I sub-telomeric cluster is important for their activity, then ablation of polyP synthesis would elicit the observed de-repression. Given that the TORC2 pathway is necessary for silencing the cluster in fission yeast, it is possible TORC2 or pathway components acting downstream are subject to lysine polyphosphorylation. Second, taking a cue from the recent studies in
|
|
|
|
|
|||
SPAC186.05c |
gdt1 |
Golgi calcium and manganese antiporter |
6.82 |
SPAC186.06 |
PhzF protein family |
5.71 |
|
SPAC750.01 |
NADP-dependent aldo/keto reductase |
5.52 |
|
SPAC186.04c |
– |
5.55 |
|
SPBPB10D8.03 |
pseudogene transporter |
1.29 |
|
SPCC1223.13 |
cbf12 |
DNA-binding transcription factor |
1.10 |
SPBC1711.15c |
Schizosaccharomyces pombe specific protein |
1.00 |
|
|
|||
SPBC16E9.16c |
lsd90 |
Lsd90 protein |
-2.05 |
SPBC1289.14 |
adducin |
-1.88 |
|
SPCC794.04c |
amino acid transmembrane transporter |
-1.80 |
|
SPACUNK4.17 |
NAD binding dehydrogenase |
-1.76 |
|
SPBPB21E7.01c |
eno102 |
enolase |
-1.63 |
SPBC336.08 |
spc24 |
NMS complex subunit |
-1.62 |
SPBC16A3.08c |
oga1 |
Stm1 homolog |
-1.61 |
SPAC15E1.02c |
DUF1761 family protein |
-1.59 |
|
SPBC354.12 |
gpd3 |
glyceraldehyde 3-phosphate dehydrogenase |
-1.57 |
SPAC27D7.03c |
mei2 |
RNA-binding protein involved in meiosis |
-1.49 |
SPBC21C3.19 |
rtc3 |
SBDS family protein |
-1.39 |
SPAP8A3.04c |
hsp9 |
heat shock protein |
-1.36 |
SPCC1235.14 |
ght5 |
high-affinity glucose/fructose:proton symporter |
-1.32 |
SPAC637.03 |
DUF1774 family |
-1.29 |
|
SPBC725.10 |
tsp0 |
mitochondrial outer membrane protein |
-1.27 |
SPBC23G7.13c |
urea transmembrane transporter |
-1.27 |
|
SPAC13G7.02c |
ssa1 |
Hsp70 family heat shock protein |
-1.18 |
SPBC660.06 |
wwm2 |
WW domain containing protein |
-1.18 |
SPCC794.09c |
tef101 |
translation elongation factor EF-1 alpha |
-1.17 |
SPAC23H3.15c |
ddr48 |
DNA damage-responsive protein |
-1.17 |
SPCC794.01c |
gcd1 |
glucose dehydrogenase |
-1.13 |
SPBPB8B6.04c |
grt1 |
DNA-binding transcription factor |
-1.09 |
SPCC737.04 |
UPF0300 family protein 6 |
-1.08 |
|
SPBC839.15c |
tef103 |
translation elongation factor EF-1 alpha |
-1.08 |
SPAC22A12.17c |
short chain dehydrogenase |
-1.07 |
|
SPAC26H5.09c |
oxidoreductase in NADPH regeneration |
-1.07 |
|
SPBC24C6.09c |
phosphoketolase family protein |
-1.07 |
|
SPAC23A1.10 |
tef102 |
translation elongation factor EF-1 alpha |
-1.07 |
SPAC1039.09 |
isp5 |
amino acid transmembrane transporter |
-1.05 |
SPCC338.12 |
pbi2 |
vaculoar proteinase B inhibitor |
-1.04 |
SPBC1815.01 |
eno101 |
enolase |
-1.04 |
SPBC29B5.02c |
isp4 |
oligopeptide transmembrane transporter |
-1.03 |
SPAC26F1.14c |
aif1 |
mitochondrial oxidoreductase |
-1.03 |
SPAC1805.10 |
Schizosaccharomyces specific protein |
-1.03 |
|
SPAC186.01 |
pfl9 |
cell surface glycoprotein, flocculin |
-1.00 |
SPCC1020.06c |
tal1 |
transaldolase |
-1.00 |
RNA was isolated from
Total RNA was prepared from exponentially growing cells (three independent cultures for each yeast strain analyzed) via the hot phenol method. The RNAs were treated with DNase I, extracted serially with phenol:chloroform and chloroform, and then precipitated with ethanol. The RNAs were resuspended in 10 mM Tris HCl (pH 6.8) and 1 mM EDTA and adjusted to a concentration of 600 ng/μl. Reverse transcription was performed with 2 μg of this RNA template plus oligo(dT)
18
and random hexamer primers by using the Maxima First Strand cDNA synthesis kit (Thermo Scientific). After cDNA synthesis for 30 min at 55˚C, the reverse transcription reaction mixtures were diluted 10-fold with water. Aliquots (2 μl) were used as templates for gene-specific quantitative PCR (qPCR) reactions directed by the sense and antisense primers listed in Reagents. The qPCR reactions were constituted with the Maxima SYBR Green/ROX master mix (Thermo Scientific) and monitored with an Applied Biosystems QuantStudio 6 Flex Real-Time PCR system. The qPCR reactions were performed in triplicate for each cDNA population. The level of individual cDNAs was calculated relative to that of
|
|
|
|
Sense |
5’–AAGTACCCCATTGAGCACGG |
Antisense |
5’–CAGTCAACAAGCAAGGGTGC |
|
|
Sense |
5’–GCGAAGAAAACCCAACAAGC |
Antisense |
5’–TCATCGTTTACTCTGATCCGTGA |
|
|
Sense |
5’–AAATTTTCCCGGGCTTTCAT |
Antisense |
5’–TCCGACAATCACCGCTACC |
|
|
Sense |
5’–GGGAGTGGAGCTGGATCAGT |
Antisense |
5’–CGCCACCAACATGAATATCG |
|
|
Sense |
5’–TATTGGGAAGACTGGGTGCTTGAAG |
Antisense |
5’–CCAACCAATTCTTCTGACACCCCA |
Primers for all genes (except for
|
|
BS78 |
|
BS128 |
|
BS623 |
|
All strains are
This work was supported by NIH grants R01-GM134021 (Beate Schwer) and R35-GM126945 (Stewart Shuman). Ana M. Sanchez is supported by NSF graduate research fellowship 1746057.