LP: Investigation, Data curation, Writing - original draft
JF: Investigation, Data curation
AN: Formal analysis
AW: Conceptualization, Data curation, Funding acquisition, Writing - review & editing, Visualization, Supervision
Cells release extracellular vesicles (EVs) from their surface, but the mechanisms that govern EV release by plasma membrane budding are poorly understood. The lipid flippase TAT-5 inhibits EV release from the plasma membrane in
(A) Embryos and oocytes were laid by
The lipid flippase TAT-5 inhibits extracellular vesicle (EV) release from the plasma membrane and maintains phosphatidylethanolamine asymmetry in
We previously found that expression of a GFP::TAT-5(E246Q) transgene failed to suppress EV release or rescue the sterility and maternal-effect embryonic lethality of
To test the effect of a partial loss of TAT-5 activity on sterility and viability, we used CRISPR/Cas9-mediated genome editing to mutate aspartic acid 244 to threonine in the DGET motif. We found that
As increased EV release is correlated with gastrulation defects and embryonic lethality (Wehman et al., 2011, Beer et al., 2018), we next examined the effect of a partial loss of TAT-5 activity on EV production. We used a degron-tagged reporter, mCh::PH::CTPD, which initially labels the plasma membrane by the PH domain binding the lipid PI
4,5
P
2
. The C-terminal phosphodegrons (CTPD) cause the intracellular pool of mCh::PH::CTPD to be degraded after the first embryonic cell division, leaving EVs already released from the plasma membrane labeled (Beer et al., 2019). We found that control embryos had an average of 3±2 mCh::PH::CTPD puncta on their surface (Fig. 1D-E). In contrast,
As large increases in EV release are also correlated with defects in phagocytosis (Fazeli et al., 2020), we next investigated polar body and midbody remnant uptake (Fazeli et al., 2016, Fazeli et al., 2018). Using the non-muscle myosin NMY-2::mCh reporter to label midbody remnants (Fazeli et al., 2016), we found that
In summary, our studies targeting the DGET motif suggest that robust TAT-5 flippase activity is required to inhibit EV release and allow phagocytosis and embryogenesis, while low levels of TAT-5 flippase activity are sufficient for fertility. While hypomorphic ATPase
Strain |
Genotype |
Source |
N2 |
Wild Type |
Brenner, 1974 |
PHX2519 |
|
SunyBiotech |
PHX2596 |
|
SunyBiotech |
WEH430 |
|
Beer et al., 2019 |
WEH434 |
|
Beer et al., 2019 |
WEH595 |
|
Crossed N2 x WEH430 x PHX2596 |
WEH599 |
|
Crossed WEH434 x PHX2596 |
DGET mutant alleles (Table 2) were created by SunyBiotech using CRISPR-Cas9-mediated genome editing (Paix et al. 2014) and verified by sequencing.
|
|
Wild Type |
CAATTGGATGGAGAAACTGAT |
|
CAATTG
|
|
CAATTGGATGG
|
Worms were lysed and
|
|
tat-5 geno F |
TGC TCC AAT CAC TTA CTG GGG AC |
tat-5 exon 5 R KpnI |
CCG GTA CCT TTC ATG GCA ACC ATA ACC |
L4 hermaphrodite larvae were singled onto 24-well plates. Embryos and oocytes laid on the plate were counted on an Olympus SZ61 one day later.
Fluorescence image stacks were collected with a Zeiss Axio Observer 7 inverted microscope with a Plan-Apo 40X 1.4 NA oil objective with Excelitas Technologies X-Cite 120LED Boost illumination, and a HamamatsuORCA-Fusion sCMOS camera controlled by 3i SlideBook6 software. Control NMY-2::mCh data was collected for Fazeli et al., 2020.
The surface z-section was rotated, cropped, and the brightness was adjusted using Adobe Photoshop 2023.
mCh::PH::CTPD puncta were marked and counted on the top surface of 3- to 15-cell embryos using the ImageJ Cell Counter function (FIJI 2.3.0). The number of fluorescent puncta in clusters were estimated according to the average size of discrete mCh::PH::CTPD puncta.
Still images were scored using 3i SlideBook6 software. Internalization was defined as when the cargo was fully inside a cell. Polar bodies were labeled with mCh::PH::CTPD and scored from the 4-cell to 28-cell stage, while midbody remnants were labeled with NMY-2::mCh and scored from the 7- to 15-cell stage. Cell stages were identified using DIC.
Statistical significance was determined using Student’s one-tailed t-test.
The authors thank Katharina Beer for technical assistance. The N2 strain was provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
This work was funded in part by Deutsche Forschungsgemeinschaft (DFG) grant WE5719/2-1 to AMW.