In our Genetics class at Williams College, students have been researching the fruit fly Drosophila melanogaster , mapping classic mutant traits to identify their associated genes. Preliminary data are collected during classroom exercises, then students are recruited into our research lab to help verify findings, complete follow-up experiments, and coauthor our discoveries (Dean et al., 2015; Dean et al., 2020; Dean et al., 2022). In a recent iteration of the lesson plan, we worked to identify purpleoid ( pd ), an unannotated eye color gene on the right arm of chromosome 2 (2R) (Bridges, 1937; Lindsley and Zimm, 1992). Wild-type ( pd ⁺ ) Drosophila have bright red eyes, while the eyes of pd ¹ flies have a relatively dull, maroon/burgundy color tone ( Figure 1A, B).

To map pd ¹ to a short chromosomal interval, pd ¹ flies were crossed to a series of stocks that carry molecularly defined deficiencies and duplications (abbreviated “Df” and “Dp” respectively; Cook et al., 2012; GenetiVision Corporation). Consistent with a previous report, pd ¹ was complemented by Df(2R)BSC659 but not by Df(2R)BSC665 ( Figure 1C, D; Kahsai and Cook, 2018). This suggested that the purpleoid locus is at least partially located within 2R:23811401..23844351. Seven protein-coding genes overlap this chromosomal segment: Nxt1 , pippin , GlyT , CG4763 , CG46398 , shu , and SNAP29 ( Figure 1G ). Subsequently, we found that pd ¹ eye color was not rescued by Dp(2;3)GV-CH321-94K01, but was rescued by Dp(2;3)GV-CH321-96I24 ( Figure 1E, F). Cross referencing these observations with JBrowse, it was seen that Nxt1 and pippin are not covered by the complementing duplication, so they were eliminated as pd candidates. GlyT is also unlikely to be the pd gene because Dp(2;3)GV-CH321-96I24, the duplication that complemented pd ¹ , begins 166 bp downstream of the only known GlyT transcription start site, so it would not be expected to express GlyT mRNA. CG4763 was also discounted because it is fully included on both duplications that were tested, yet only one of these duplications rescued pd ¹ . Thus, the duplication cross results narrowed the list of purpleoid candidates to CG46398 , shu , and SNAP29 (highlighted subregion in Figure 1G ). No CG46398 mutant stocks were available for phenotypic analysis, but two different RNA-seq projects had failed to detect significant CG46398 expression outside of the male reproductive organs, which argues against a role for CG46398 in the eye color development of both sexes (Brown et al., 2014; Leader et al., 2018). This left shu and SNAP29 as the final purpleoid candidates.

Fly strains carrying loss of function, homozygous-lethal mutations in shu and SNAP29 were available from the Bloomington Stock Center, enabling us to conduct a round of gene-specific complementation tests. Kahsai and Cook (2018) reported that shu ² had complemented pd ¹ , and we replicated this result. In addition, we found that P{EPgy2} shu ^EY08563 , a P -element insertion in the 5’-UTR of shu , also complemented pd ¹ . This was further evidence that the pd ¹ phenotype is not due to a mutation in shu . Kahsai and Cook (2018) did not test SNAP29 as the pd gene because they had a broader goal of mapping many different Chromosome 2 mutations, but in our experiments, we found that SNAP29 ^B6-21 , an amorphic SNAP29 allele, failed to complement pd ¹ ( Figure 1H- J). Furthermore, ubiquitous misexpression of a UAS- CFP.SNAP29 construct in pd ¹ flies rescued the eye color phenotype ( Figure 1K- M; SNAP29 ^B6-21 and UAS construct described in Morelli et al., 2014). Lastly, the SNAP29 gene of pd ¹ flies was sequenced, and a C T G to C G G missense mutation was detected relative to pd ⁺ controls; this would substitute a positively-charged arginine for a hydrophobic leucine in the coded protein (L134R, Figure 1N ; GenBank accession number PQ857573).

These results strongly indicate that SNAP29 is the purpleoid gene, or more precisely, that the pd ¹ eye color phenotype is due to a mutation in SNAP29 . Calvin Bridges first observed the pd ¹ phenotype in 1916 (Bridges, 1937). Since then, pd ¹ strains have been cultivated by researchers and stock centers, but the affected gene had not been determined until this study. Bridges’ investigations have been an integral part of undergraduate genetics curricula for many decades, so identifying the purpleoid gene has educational as well as historical value.

SNAP29 ( Synaptosomal-associated protein 29kDa ) encodes a member of the SNARE (Soluble N-ethylmaleimide attachment protein receptor) family, a group of proteins that facilitate vesicle fusion with cellular membranes. SNAREs fall into two subcategories according to their polypeptide sequences and intracellular localizations: t-SNARE proteins such as SNAP29 are cytoplasmic and tethered to a cell membrane “ t arget”, while v-SNAREs are associated with the membranes of v esicles such as lysosomes. Binding between vesicle v-SNARE and cell membrane t-SNARE coiled-coil domains enables vesicle attachment to the target membrane. This “docking” step is followed by membrane fusion and release of vesicle content through the cellular membrane on which the vesicle had attached (Fasshauer et al., 1998; Harbury, 1998; Khvotchev and Soloviev, 2022; Yang et al., 2023).

Previous research has shown that Drosophila SNAREs affect vesicle trafficking during synaptic transmission and autophagy ( e.g. , Rao et al., 2001; Vilinsky et al., 2002; Haberman et al., 2012; Lőrincz et al., 2016; Chang et al., 2024). Our data indicate that SNARE activity affects eye pigmentation as well. This makes sense considering circumstantial evidence from past studies of lysosomal trafficking and eye color development. Drosophila eye color pigments (brown ommochromes and red drosopterins) are deposited in specialized lysosomes called pigment granules, and there are multiple loci that regulate lysosome biogenesis and also affect eye color. Of particular relevance, the eye color genes deep orange , carnation , and light encode members of the HOPS/CORVET complex, an assembly of proteins that help recruit SNAREs to the membrane. pd ¹ is semilethal in combination with a mutation in deep orange , suggesting a functional interaction between SNAP29 and the HOPS/CORVET complex (Lucchesi, 1968; Ooi et al., 1997; Simpson et al., 1997; Lloyd et al., 1998; Sevrioukov et al., 1999; Akbar et al., 2009; Solinger and Spang, 2013; Grant et al., 2016; Lőrincz et al., 2016).

SNAP29 ^B6-21 , the only other confirmed and available Drosophila SNAP29 mutant allele, is a nonsense, amorphic mutation, making it an invaluable resource to assess the consequences of strong loss of SNAP29 function (Morelli et al., 2014). However, SNAP29 ^B6-21 has limitations as an investigative tool: (1) it is homozygous lethal shortly after larval hatching, well before the adult eye has formed (however, SNAP29 ^B6-21 mitotic clones have been successfully generated and analyzed in the developing adult eye—see Morelli et al., 2014; Morelli et al., 2016); (2) SNAP29 ^B6-21 /+ heterozygotes are viable but have an eye color tone that overlaps with wild type ( Figure 1I ); and (3) the SNAP29 ^B6-21 mutation places a stop codon before the second t-SNARE domain, removing 116 amino acids from the C-terminus of a 284 amino acid protein (Morelli et al. , 2014). Such a severe truncation is likely to disrupt the folding and function of the remaining polypeptide, so SNAP29 ^B6-21 is unlikely to reveal the role of any specific SNAP29 domain.

On the other hand, pd ¹ is a missense mutation in a functionally important domain of SNAP29 , so it offers advantages that complement those of SNAP29 ^B6-21 : (1) pd ¹ homozygotes are viable and have good fitness; (2) with proper lighting (see Methods), the eye color of pd ¹ homozygotes is easily distinguished from that of wild-type flies ( Figure 1A, B); and (3) pd ¹ is expected to have a relatively specific effect on SNAP29 structure/function because, while SNAP29 ^B6-21 produces a truncated protein, pd ¹ substitutes arginine, a charged residue, for a leucine along the hydrophobic face of a predicted α-helix within the first t-SNARE coiled coil domain ( Figure 1N ). Amino acid substitutions in the coiled coil domains of other SNARE proteins affect formation, stability, and function of the t-SNARE/v-SNARE complex (Brennwald et al., 1994; Nonet et al., 1997; Saifee et al., 1998; Rao et al. 2001). Taken together, pd ¹ has potential for future study. For example, it genetically interacts with mutations in deep orange and garnet , two genes that affect lysosomal delivery to membrane-bound pigment granules (Lucchesi, 1968; Lloyd et al., 1998), so the pd ¹ phenotype could be a useful reference point in genetic modifier screens. pd ¹ might also assist protein-level studies. Techniques such as coimmunoprecipitation, SDS-PAGE, Western blotting, and mass spectroscopy have successfully identified SNARE binding partners, as well as factors that affect their assembly ( e.g. , Itakura et al., 2012; Jiang et al., 2014; Yang et al., 2015; Li et al., 2022). This in mind, it seems feasible to compare the SNARE protein complex components of wild-type and pd ¹ flies. Additional fly strains could be created, each with a different missense mutation at a different site along the SNAP29 gene, and subjected to similar analysis.

Fly stocks and experimental crosses: The following fly stocks were obtained from the Bloomington Drosophila Stock Center (BDSC):

· Oregon-R-P2 (“ pd ⁺ ”; BDSC 2376)

· pd ¹ Phm ^ll-1 (BDSC 362)

· w ¹¹¹⁸ ; Df(2R)BSC659/SM6a (BDSC 26511)

· w ¹¹¹⁸ ; Df(2R)BSC665/SM6a (BDSC 26517)

· w ¹¹¹⁸ ; Dp(2;3)GV-CH321-94K01 (BDSC 90653)

· w ¹¹¹⁸ ; Dp(2;3)GV-CH321-96I24 (BDSC 90661)

· cn ¹ bw ¹ shu ² sp ¹ /CyO, l(2)DTS513 ¹ (BDSC 5109; Munn and Steward, 2000)

· y ¹ w ^67c23 ; P{ y ^+mDint2 w ^+mC =EPgy2} shu ^EY08563 (BDSC 17473; Bellen et al., 2004)

· w* ; P{ ry ^+t7.2 =neoFRT}42D Snap29 ^B6-21 /CyO, P{ w ^+mC =GAL4-twi.G}2.2, P{ w ^+mC =UAS-2xEGFP}AH2.2 (BDSC 56818)

· y ¹ w* ; P{ w ^+mC = tub P-GAL4}LL7/TM3, Sb ¹ Ser ¹ (BDSC 5138; Lee and Luo, 1999)

· w* ; M{ w ^+mC =UAS- CFP.Snap29 }ZH-86Fb (BDSC 56817)

Flies were fed the modified yeast/dextrose/cornmeal diet described in Dean et al. (2020). Experimental crosses were conducted at 25°C. Mating schemes are available upon request. Experimental cross progeny were scored by at least two authors independently. Cross results were analyzed with the bioinformatic data available on FlyBase and JBrowse (Jenkins et al., 2022; Öztürk-Çolak et al., 2024).

Photography: A Zeiss Stemi 305 dissecting scope and its camera were used to image fly eyes. We found that pd ¹ eye color was much easier to discern with side lighting than with overhead lighting, so rather than using the installed overhead microscope light, two desk lamps, each fitted with a TCP Dimmable A-19 LED bulb (15W 1675 lumen 5000K), were positioned on opposite sides of the microscope stage and pointed directly towards the specimen. Adult flies 1-4 days old were collected and stored at -20°C for no more than a week, then photographed at 30X magnification under a locked camera setting (23 msec exposure, gain 0, gamma 32, contrast 8, saturation 12, RGB 21/12/26, brightness 9, sharpness 3, denoise 5). Each fly was imaged at multiple focal planes to view the entire eye. The photo series for each fly was imported into Adobe Photoshop 2021 and focal stacked (Dean et al., 2022). Photos had been intentionally underexposed with only moderate contrast to avoid loss of color information by clipping. To better represent the color balance and contrast that had been seen through the microscope, while still avoiding clipping, each stacked image was given the following post-production modifications: exposure was increased +0.7, contrast was increased +20, one sharpen filter was added, and white balance was slightly adjusted using an image of an 18% gray card (Delta Photography Supplies) that had been photographed under the same conditions as the fly specimens had been.

DNA sequencing and sequence analysis: Standard “squish preps” were used to extract DNA from pd ⁺ and pd ¹ adult flies, two independent extractions per genotype (Gloor and Engels, 1992; Gloor et al., 1993). The SNAP29 gene was amplified from each extract using Q5 DNA polymerase from New England Biolabs, the manufacturer’s recommended protocol, and the following PCR primers (synthesized by Integrated DNA Technologies):

· SNAP29for7: CGCTATTGCAATCGATAACTCC (forward primer, anneals to 5’-UTR)

· SNAP29rev7: AGGAATGCATTCTTAATGGCC (reverse primer, anneals to 3’-UTR)

PCR products were run through a 0.8% low melt agarose gel and extracted from gel slabs using the Monarch DNA Gel Extraction Kit (New England Biolabs). The forward and reverse strands of each product were sequenced with Sanger sequencing by the Cornell Institute of Biotechnology (Ithaca, NY), using the PCR primers listed above. Within the windows of high-quality sequence, no mismatches were seen between the forward and reverse strand readings of a sample or between the replicates of a given genotype.

The nucleotide sequence of the pd ¹ strain SNAP29 gene is deposited in NCBI under GenBank accession number PQ857573. To generate the SNAP29 protein alignments shown in Figure 1N, the translation of the pd ¹ SNAP29 sequence was queried in a BLASTx (Camacho et al., 2009) against Drosophila SNAP29 protein (accession number NP_523831.1), and then the Drosophila SNAP29 protein sequence was queried in protein BLASTs against NP_505641.2 ( C. elegans ), NP_001243185.1 (zebrafish), NP_075837.3 (mouse), and NP_004773.1 (human).

No AI was used in this project for data collection, writing, editing, or figure generation.