In 1933, Calvin Bridges discovered a recessive mutation on the Drosophila melanogaster fourth chromosome that reduces or eliminates the scutoscutellar sulcus—the transverse groove separating the larger subdivision of the notum, the scutum, from the smaller subdivision, the scutellum. He named the mutated gene grooveless ( gvl ) for this phenotype (Bridges 1935). Figures 1A and B show wild type thoraces while Figures 1C–E show the grooveless phenotype. Bridges noted that clotted hemolymph is sometimes seen in mutants at the lateral ends of sulci and near the sternopleural and humeral bristles ( Figure 1F ). The original mutation, gvl ¹ , has been used as a recessive visible marker for tracking the fourth chromosome and mapping mutations, but has otherwise received little attention—even though flexion between the scutum and scutellum at the scutoscutellar sulcus is a part of normal flight (Boettinger and Furshpan 1952; Miyan and Ewing 1985).

 

Sturtevant (Sturtevant 1951) and Hochman (Hochman et al. 1964) localized gvl to the proximal part of the fourth chromosome. Unpublished work by the DrosDel consortium (Ryder et al. 2007) documented in FlyBase (Öztürk-Çolak et al. 2024) further localized gvl to a genomic interval encompassed by Df(4)ED6366 containing eight protein-coding genes and three noncoding RNA genes . Hochman and colleagues showed that gvl ¹ complemented all mutations in loci necessary for viability identified in their extensive characterization of the fourth chromosome (Hochman 1976). Because they isolated mutations in nearly every fourth chromosome gene that could be mutated to lethality (Weasner et al. 2025), the null phenotype of gvl is unlikely to be lethality.

 

We verified the DrosDel mapping of gvl ¹ to Df(4)ED6366 and complementation tested gvl ¹ against loss-of-function mutations in the eight protein-coding genes within the region of Df(4)ED6366 : Ank ^A , Ank ^J , anne ^D , CG32006 ^CR70476-kG4 , CG31997 ^{CR70475-TG4.1} , CG33978 ^B , Arl4 ^D , Abcd1 ^A , Abcd1 ^K and pan ^ciD (though Hochman (1976) demonstrated that gvl ¹ was not an allele of pan ). We found that gvl ¹ and Df(4)ED6366 failed to complement CG31997 ^{CR70475-TG4.1} and that flies homozygous for this allele show shallow scutoscutellar sulci. Subsequently, another CG31997 allele ( CG31997 ^P ) became available from the Fourth Chromosome Resource Project (Weasner et al. 2025). It is a frameshift mutation (deletion of bases 4:155817 through 155821) predicted to add an arginine after residue 28 of the 147-amino acid CG31997 protein before truncating the protein; consequently, it is likely a null allele. It failed to complement gvl ¹ , CG31997 ^{CR70475-TG4.1} and Df(4)ED6366 as well as a derivative of CG31997 ^{CR70475-TG4.1} called CG31997 ^{CR70475-DH.PT-GFSTF.1} , and it showed the abnormal sulcus phenotype when homozygous. Interestingly, many flies from noncomplementing crosses involving CG31997 ^P and many flies homozygous for CG31997 ^P showed scutellar, humeral and/or sternopleural clots—phenotypes we did not see as frequently in stocks with other alleles or in crosses involving alleles other than CG31997 ^P . Since hemolymph leakage seems particularly deleterious, we suspect suppressors of this phenotype accumulate in gvl stocks. Heteroallelic flies with gvl ¹ , CG31997 ^{CR70475-TG4.1} or CG31997 ^{CR70475-DH.PT-GFSTF.1} combined with CG31997 ^P and flies with CG31997 ^P combined with Df(4)ED6366 were capable of flight, but we did not assess flight duration or efficiency, nor the details of thoracic movement.

 

Whole-genome sequencing of Bloomington Drosophila Stock Center stocks 640 and 650 showed that gvl ¹ is a 545 bp deficiency (bases 4:155948 through 4:156492 deleted) removing 72% of the CG31997 5’ UTR and 29% of the adjacent CG31997–CG33978 intergenic region ( Figure 1G ). Thirty-three bp of unknown origin (AAAAAAAAATAAAATTAAATACAAATTTAATTG) are inserted at the breakpoint junction.

 

CG31997 , which we now call grooveless , encodes a protein with a single von Willibrand factor type C (SVWC) domain and a cell export signal, but no other known protein motifs (Sheldon et al. 2007). Proteins with a SVWC domain appear to be restricted to arthropods, but the biological functions of very few of these proteins are known (Labropoulou et al. 2024). Of the fourteen D. melanogaster genes annotated as SVWC genes in FlyBase (Öztürk-Çolak et al. 2024), only Vago has been characterized in depth. It encodes a protein with interferon-like activities in immunity (Xia et al. 2025). Our molecular identification of gvl represents the first example of a SVWC gene involved in morphogenesis and offers new opportunities to study thoracic development and the role of the hinge-like movement of the scutum and scutellum in the mechanics of flight.

 

 

 

The stocks used in complementation tests are listed in the Reagents Table. More information about these stocks may be obtained via the website for the Bloomington Drosophila Stock Center (https://bdsc.indiana.edu/). Genetic nomenclature and gene models reflect FlyBase release 2025_5 (Öztürk-Çolak et al. 2024). DNA was extracted from frozen samples of 15 adult flies using standard protocols and sequenced as single-end reads on the Ultima Genomics platform by the University of Minnesota Model Organism Sequencing Service (https://genomics.umn.edu/service/model-organism-sequencing). DNA yields averaged 1,082 ng per sample with mean NanoDrop A260/280 and A260/230 ratios of 1.83 and 0.79. For stocks 640 and 650, mean genome coverages were 57x and 77x and alignment rates to the D. melanogaster Release 6 reference genome assembly were 94.17% and 87.48%, respectively.